Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is the significance of Axial skeleton? The bones which make up skeleton of the main body axis of vertebrates. It comprise the cranium, vertebral column, and rib cages, How
Define Fluids requirement to avoid underweight problem? Take fluids only after a meal instead of with or before meals so that food intake is not reduced. High calorie nourishin
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Legal level -Pollution control Pollution must be controlled by effective legislation also. Like USA, Japan, Germany and many other countries a comprehensive legislation for pr
Do all genetic diseases result from alteration in the number of chromosomes of the cells? Besides aneuploidies there are other genetic diseases, other chromosomal abnormalities
Explain the Malthus' Theory about population growth? Darwin's Theory was also based on Thomas Malthus' writings on population growth, in which he explained that populations gro
The diet of a MSUD patient (child) should therefore involve: • Measured quantities of natural protein or leucine from foods. • A BCAA free protein, vitamin and mineral supp
Q. What are the endocrine glands that regulate sexual activity in males? How does this regulation work and what are the involved hormones? In males the sexual activity is regul
How do the products of meiosis I differ from those of meiosis II? In meiosis I, the offspring cells are haploid but every cell contains two copies of the chromosome because th
Q. Is monoculture a system that contributes to great biological diversity of an ecosystem? The Monoculture implies that in a large area a single crop (only one species of plant
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd