pisces, Biology

Assignment Help:
what is the mode of nutrition in pisces

Related Discussions:- pisces

What is the significance of axial skeleton, What is the significance of Axi...

What is the significance of Axial skeleton? The bones which make up skeleton of the main body axis of vertebrates. It comprise the cranium, vertebral column, and rib cages, How

Define fluids requirement to avoid underweight problem, Define Fluids requi...

Define Fluids requirement to avoid underweight problem? Take fluids only after a meal instead of with or before meals so that food intake is not reduced. High calorie nourishin

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Legal level -pollution control, Legal level -Pollution control Polluti...

Legal level -Pollution control Pollution must be controlled by effective legislation also. Like USA, Japan, Germany and many other countries a comprehensive legislation for pr

Do all genetic diseases result no. chromosomes of the cells, Do all genetic...

Do all genetic diseases result from alteration in the number of chromosomes of the cells? Besides aneuploidies there are other genetic diseases, other chromosomal abnormalities

Explain the malthus theory about population growth, Explain the Malthus' Th...

Explain the Malthus' Theory about population growth? Darwin's Theory was also based on Thomas Malthus' writings on population growth, in which he explained that populations gro

Diet of a msud patient, The diet of a MSUD patient (child) should therefore...

The diet of a MSUD patient (child) should therefore involve: • Measured quantities of natural protein or leucine from foods. • A BCAA free protein, vitamin and mineral supp

Endocrine glands that regulate sexual activity in males, Q. What are the en...

Q. What are the endocrine glands that regulate sexual activity in males? How does this regulation work and what are the involved hormones? In males the sexual activity is regul

How do the products of meiosis i differ from of meiosis ii, How do the prod...

How do the products of meiosis I differ from those of meiosis II? In meiosis I, the offspring cells are haploid but every cell contains two copies of the chromosome because th

Biological diversity of an ecosystem, Q. Is monoculture a system that contr...

Q. Is monoculture a system that contributes to great biological diversity of an ecosystem? The Monoculture implies that in a large area a single crop (only one species of plant

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd