Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Phytochrome - Floral Induction
Phytochrome a pigment that exists in two different inter convertible forms was discovered by Hendricks and Borthwrick et. al. and was chemically extracted and purified. Since then exact chemical nature is now established. Phytochrome has two parts the light absorbing portion (chromophore) and the large protein. Action spectra of photoperiodism, germination, and breaking of dormancy etc.-clearly establish phytochrome as the 'photomorphogenesis' pigment as its absorption spectra genuinely overlaps the action spectra of the above phenomenon. Phytochrome was found located mostly in the cell membranes. It exists in red-light absorbing form and far-red light absorbing forms. Phytochrome (R) absorbs red light and is converted into phytochrome (FR), a far-red light absorbing form.
Phytochrome Fr on exposure to far red light is reconverted to phytochrome R. Phytochrome (Fr) can also be converted to phytochrome (R) in prolonged darkness. The action of phytochrome through gene repression and depression production of flowering inducing hormones enzyme activation leading to 'floral apex' from a vegetative apex is roughly understood. But all the steps are not clear yet. Phytochrome regulated morphogenesis results for change in gene 13 transcription. Several phytochrome activated genes have been identified and isolated. One of them is PAL gene.
If a color blind man marries a woman pure for normal color vision, it's probable that one of the below situations may result. Is it possible that a) All the children would be
Which of the following are bound to hemoglobin when hemoglobin is in the R-state? Choose all that apply. 1. Fe2+ 2. CO2 3. 2,3-bisphosphoglycerate 4. Fe3+ 5. Oxygen
What are universal donors and universal recipients concerning the ABO blood system? The Universals donors of the ABO blood type system are the individuals of the type O. The Ty
Provide the Definition of Health Care? Health care involves much more than just medical care and can be defined as "multitude of services provided to individuals or communities
ENDOPLASMIC RETICULUM Bulk of the cytoplasmic compartment of a cell is occupied by complex , continuous channel system in the form a network of closed membrane bound and
Bacterial and Mycotic Diseases Bacteria and fungi are microscopic organisms which are ubiquitous in nature and are widely present in soil, fresh and salt water, air, vegetation
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Advantages and Disadvantage of using Turbidity Measurement? Advantages 1. It is an easy, rapid and sensitive technique. 2. Turbidity measurement can be done without destr
What do you understand by Parapodia? Paired lateral, unjointed appendages of polychaete worms. Parapodia have a variety of shapes, and their appearance is related to their nume
You have identified a protein in a cell that you know that comes from the human body. With respect to that protein you have also determined that it allows sodium ions to go through
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd