Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Phytochrome - Development of plant
You know that plants capture light energy during photosynthesis, now you are familiarised with another important and interesting role of light in developmental' phenomena. Just as for photosynthesis lie is absorbed by pigments chlorophylls and carotenoids, similarly to bring about developmental response light has to be absorbed by some pigments. One of the pigments that detects the quality of light in the range of 600-800 nm region is phytochrome. It may also be mentioned that some developmental changes do exist even in total darkness. These processes would be independent of active form of phytochrome. Such changes are called skotomorphogenetic as against photomorphogenesis change that occur in light. There also exists an unidentified blue light absorbing pigment which brings about phototropism and nastic movements.
How does iodine kill germs? The microbiocidal action of Iodine is because of the active form, I2, which is polarized by water and like all halogens (chlorine, fluorine, bromine
What are the major functions of the organic molecules for living beings? Organic molecules, such as proteins, lipids and carbohydrates, perform numerous functions for living or
(a)What do you understand by the term 'monoculture'? (b) What is one disadvantage of a monoculture? a) 'Monoculture' is the term applied to the growing
Levels of organization of Matter- Metazoa The smallest structural units of all matter are subatomic particles, mainly electrons, protons and neutrons. The next larger units a
Synapse Nervous System Structural feature of unique importance in the nervous tissue is the synapse. A synapse is the anatomical site at which axon terminal processes of one
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
CARDINAL MANIFESTATION OF CARDIOVASCULAR DISORDERS Cardiovascular symptoms that most often trouble patients are: 1. Chest Pain 2. Shortness of Breath 3. Palpitation
The article entitled "Life on Earth" is trying to make the point that RNA likely included before DNA. Forthis article which of the following is false? A. Chains of RNA nucleoti
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Red-green colour blindness is X-linked recessive. A woman with normal colour vision has a father who is red-green colour-blind. The woman has four sons, none of whom are colour-bli
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd