Physiognomy and pattern, Biology

Assignment Help:

Physiognomy and Pattern

Physiognomy is the general appearance of vegetation as determined by the growth, form of dominant species. It may be considered a synthetic character because the appearance is based on a number of qualitative characteristics such as the kind of dominant species, life form, population density, cover, height, sociability, stratification, and association of species.

For example, if we look at a community where large trees are dominant and some shrubs are also present we would immediately say that it is a forest. Similarly on the basis of appearance one can identify a community as grassland or desert community. Pattern refers to whether the vegetation occurs in the form of groups or clumps of individuals or in any other non-random arrangement.


Related Discussions:- Physiognomy and pattern

Explain types known in metabolic pathways, How many regulatory enzyme types...

How many regulatory enzyme types known in metabolic pathways, explain in detail by giving examples.

Hmp shunt in erythrocytes, HMP shunt in erythrocytes HMP shunt in eryth...

HMP shunt in erythrocytes HMP shunt in erythrocytes is of importance due to the generation of NADPH, which maintains the glutathione (G-SH)  in  the reduced  state by  glutathi

TISSUES, difference between axon and cyton

difference between axon and cyton

Illustrate erythropoietin, Define Erythropoietin A. acts by stimulating...

Define Erythropoietin A. acts by stimulating the production of red blood cells by the peritubular interstitial cells of the kidney cortex. B. is secreted by cells in the bon

Isomerization of dihydroxyacetone phosphate, Isomerization of dihydroxyacet...

Isomerization of dihydroxyacetone phosphate Isomerization  of  dihydroxyacetone phosphate: Triosephosphate isomerase interconverts  dihydroxyacetone phosphate and  glyceralde

Pollination, how pollination occurs in Salvia?

how pollination occurs in Salvia?

Explain risk assessment, Explain Risk Assessment Risk Assessment   :  ...

Explain Risk Assessment Risk Assessment   :  The scientific evaluation  of  known  or  potential adverse  health effects  resulting  from  human exposure to food borne hazards

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Endocrine glands, Endocrine glands Endocrine glands have no ducts - ...

Endocrine glands Endocrine glands have no ducts - so these are also called as ductless glands Eg.Pituitary etc., These glands secrete chemical substances called HORMONES

Describe the function of gastrin in the digestive process, Q.How is it prod...

Q.How is it produced and what is the function of gastrin in the digestive process? The existence of food in the stomach stimulates the secretion of gastrin that in its turn tri

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd