Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Physiognomy and Pattern
Physiognomy is the general appearance of vegetation as determined by the growth, form of dominant species. It may be considered a synthetic character because the appearance is based on a number of qualitative characteristics such as the kind of dominant species, life form, population density, cover, height, sociability, stratification, and association of species.
For example, if we look at a community where large trees are dominant and some shrubs are also present we would immediately say that it is a forest. Similarly on the basis of appearance one can identify a community as grassland or desert community. Pattern refers to whether the vegetation occurs in the form of groups or clumps of individuals or in any other non-random arrangement.
How many regulatory enzyme types known in metabolic pathways, explain in detail by giving examples.
HMP shunt in erythrocytes HMP shunt in erythrocytes is of importance due to the generation of NADPH, which maintains the glutathione (G-SH) in the reduced state by glutathi
difference between axon and cyton
Define Erythropoietin A. acts by stimulating the production of red blood cells by the peritubular interstitial cells of the kidney cortex. B. is secreted by cells in the bon
Isomerization of dihydroxyacetone phosphate Isomerization of dihydroxyacetone phosphate: Triosephosphate isomerase interconverts dihydroxyacetone phosphate and glyceralde
how pollination occurs in Salvia?
Explain Risk Assessment Risk Assessment : The scientific evaluation of known or potential adverse health effects resulting from human exposure to food borne hazards
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Endocrine glands Endocrine glands have no ducts - so these are also called as ductless glands Eg.Pituitary etc., These glands secrete chemical substances called HORMONES
Q.How is it produced and what is the function of gastrin in the digestive process? The existence of food in the stomach stimulates the secretion of gastrin that in its turn tri
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd