Physical environment and genetics, Biology

Assignment Help:

Physical Environment and Genetic

Physical Environment:

Safe water and clean air, healthy workplace, safe houses, communication and roads all contribute to good health. The choice of the location of one’s living and work place is determined by the socio-economic and educational background of the individual. There is thus inter-dependency among these broad factors also.

Genetics:

Hereditary factors inherited genetically play an important role in determining the quality of life vis-à-vis the health status and the likelihood of developing certain diseases. Personal behaviour and coping skills (which depends on factors like balanced diet, keeping oneself clean and active, keeping oneself away from habits like smoking/drinking, etc.) are important determinants of the health status of individuals.
It follows from the above that while the context of people’s lives are largely responsible for their health status, individuals would have little direct control over the factors influencing them. The governments and institutions play an important contributory role in promoting the health of the people and the society. At a macro level, factors like the level of economic development, opportunities for earning income and wealth, policies pursued for alleviating poverty and promotion of social sector institutions, etc., contribute to determining the health status of a community.The present unit focuses on discussing some of these related aspects which determine the health status of the people in a country.

Education/Gender:

Low education levels are linked with poor health, more stress and lower self-confidence. Men and women suffer from different types of diseases, specific to their biological and other factors, at different ages.


Related Discussions:- Physical environment and genetics

In what form nitrogenous wastes excreted in birds, In what forms are nitrog...

In what forms are nitrogenous wastes excreted in birds, humans and aquatic turtles respectively ? Why so, describe?

Pre-operative planning and implant exposure, Q. Pre-operative Planning and ...

Q. Pre-operative Planning and Implant Exposure? A hollow acrylic transitional restoration should be fabricated based on the original diagnostic preview with respect to the toot

Assume complete absorption, How many pints (473 ml) of Fat Tire amber ale c...

How many pints (473 ml) of Fat Tire amber ale can an 80 kg person drink in Arizona before reaching the blood alcohol limit? Fat Tire's ethanol concentration of 5.3% (v/v). Assume c

Define some texturization processes, Known physicochemical basis of some of...

Known physicochemical basis of some of these texturization processes are presented below: 1.Thermal Coagulation and Film Formation: Concentrated soy proteins can be thermally

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define food processing unit operations, Define Food processing unit operati...

Define Food processing unit operations? Food processing unit operations are involved in the engineering aspects of food processing, packaging and storage. Heating, cooling, dry

Are there differences between the male and female skeletons, Q. Are there d...

Q. Are there differences between the male and female skeletons? Many general differences exist between female and male skeletons. Male skeleton is normally larger and heavier t

The cardiac cycle during which the ventricles are filled, What is the stage...

What is the stage of the cardiac cycle during which the ventricles are filled? The filling of the ventricles with blood happens during diastole. The Circulatory System - Ima

Quality adjusted life years (qalys), Normal 0 false false f...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Skin and cornea grafting, SKI N GRAFTING - Skin for grafting is taken ...

SKI N GRAFTING - Skin for grafting is taken from another part of body of the same persons. Now it is possible to grow a sheet of skin in culture from a small piece of skin

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd