Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Write the definition of communication? Communication is "a process of transmitting ideas, information, attitudes (images which we have formulated for ourselves) by the use o
describe the endoskeleton of fish?
Q. How is the gymnosperm seeds formed? What are the ploidies of the structures that compose the seeds? Their seeds are produced from differentiation of the megasporangia in the
Artificial respiration First - aid for drowning victims should aim to restore respiration as quickly as possible. First of all, nose, mouth and throat of the victim shoul
Vibriosis/campylobacteriosis This is genital disease of cattle and sheep. The causal organism Campylobacter fetus is a gram negative, curved or spiral shaped bacteria having s
Explain the Economic and Social Burden ? Cardio-vascular diseases pose tremendous economic strain on the population and the countries throughout the world. However there is a d
Properties of pyridoxine a) It forms white, odourless crystals. b) The compound is readily soluble in water. c) When a neutral or alkaline solution of pyridoxine is
The secretary coil fills the lumen with a NaCl solution that is isotonic with the blood plasma. As this solution moves upward through the reabsorptive duct, NaCl is reabsorbed into
Define Requirements for underwater weighing method? • The equipment required to perform hydrostatic measurements is bulky and maintenance intense. • A large tank of water, usu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd