Phylum placozoa, Biology

Assignment Help:

Phylum Placozoa

The phylum Placozoa contains a single species of a minute marine animal Trichoplax adharens composed of a dorsal and ventral epithelial layer enclosing loose mesenchyme like cells. Mesozoans comprise some 50 species of small parasitic worms that have simple structures made up of 20-30 ciliated cells covering a few reproductive cells.


Related Discussions:- Phylum placozoa

Solubility of gases in water, Solubility of Gases in water Most gases w...

Solubility of Gases in water Most gases which are important for biological processes dissolve readily and specially in water. The solubility of any gas in water generally var

What is aquatic biodiversity, Q. What is aquatic biodiversity? Biodiver...

Q. What is aquatic biodiversity? Biodiversity found on Earth today is the result of 3.5 billion years of evolution. Until the emergence of humans, the Earth supported more biod

Relationship between whales and hippos, In the evolution of whales, there i...

In the evolution of whales, there is evidence that whales and hippo form a monophyletic group. Show all the evidence that supports the close relationship between whales and hippos

How is the gymnosperm seeds formed, Q. How is the gymnosperm seeds formed? ...

Q. How is the gymnosperm seeds formed? What are the ploidies of the structures that compose the seeds? Their seeds are produced from differentiation of the megasporangia in the

Goals of dietary treatment for dyslipidemia, Q. Goals of Dietary Treatment ...

Q. Goals of Dietary Treatment for dyslipidemia? The goals of dietary management (alone or conjunction with exercise or with lipid lowering drugs) are to reduce the total fat, s

importance of water in the body, Importance of water in the body Wa...

Importance of water in the body Water is the most essential constituent of life. Life cannot exist without water. About 90% of water is present in protoplasm  Water

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Show the error detection and editing function, Q. Show the Error Detection ...

Q. Show the Error Detection and Editing Function? Error Detection and Editing Function: Consciousness helps us avoid acting solely through habit. It allows us to make novel res

Respiratory care on admission of patient, Respiratory Care on Admission (Fi...

Respiratory Care on Admission (First two hours) Patient is incubated and ventilator-dependent.  Monitor blood gases hourly and take corrective action immediately.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd