Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Phylum Placozoa
The phylum Placozoa contains a single species of a minute marine animal Trichoplax adharens composed of a dorsal and ventral epithelial layer enclosing loose mesenchyme like cells. Mesozoans comprise some 50 species of small parasitic worms that have simple structures made up of 20-30 ciliated cells covering a few reproductive cells.
Solubility of Gases in water Most gases which are important for biological processes dissolve readily and specially in water. The solubility of any gas in water generally var
Q. What is aquatic biodiversity? Biodiversity found on Earth today is the result of 3.5 billion years of evolution. Until the emergence of humans, the Earth supported more biod
In the evolution of whales, there is evidence that whales and hippo form a monophyletic group. Show all the evidence that supports the close relationship between whales and hippos
Q. How is the gymnosperm seeds formed? What are the ploidies of the structures that compose the seeds? Their seeds are produced from differentiation of the megasporangia in the
Q. Goals of Dietary Treatment for dyslipidemia? The goals of dietary management (alone or conjunction with exercise or with lipid lowering drugs) are to reduce the total fat, s
Importance of water in the body Water is the most essential constituent of life. Life cannot exist without water. About 90% of water is present in protoplasm Water
characterstic of phylum arthropoda
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Show the Error Detection and Editing Function? Error Detection and Editing Function: Consciousness helps us avoid acting solely through habit. It allows us to make novel res
Respiratory Care on Admission (First two hours) Patient is incubated and ventilator-dependent. Monitor blood gases hourly and take corrective action immediately.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd