phylum patehelminthes, Biology

Assignment Help:
explian te topic

Related Discussions:- phylum patehelminthes

How to characterized chordate, Q. Chordate identity card. How are they char...

Q. Chordate identity card. How are they characterized according to examples of representing beings, type of symmetry, basic morphology, germ layers and coelom, digestive system, ci

Forms of soil water, Forms of Soil Water Gravitational Water or Groun...

Forms of Soil Water Gravitational Water or Ground Water: After a heavy rain or irrigation, much of the water drains or sinks downwards. This is called gravitational water.

Issues impacting health and development - inequity, Normal 0 fa...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Male gamete and the female gamete in a flowering plant, What is (a) the mal...

What is (a) the male gamete, and (b) the female gamete in a flowering plant?   (a) The male gamete in a flowering plant is the pollen grain (strictly, the gamete is the male

Thermal stratification - lake ecosystem, Thermal Stratification - Lake Ecos...

Thermal Stratification - Lake Ecosystem Shallow lakes show no thermal stratification as their waters are well mixed, resulting in uniform temperature throughout. However lakes

Equipment of circulatory assist devices, Equipment :  Basically, it has an...

Equipment :  Basically, it has an intra aortic balloon pump. A balloon with a capacity of 40 ml is passed percutaneously through the femoral artery up to the upper end of descen

Basis of classification on form-relationship principle, Q. Basis of Classif...

Q. Basis of Classification on Form-relationship principle? As pointed out earlier, this system is mainly based on Form-relationship principle. thus the various genera were. g

Wbcs types, mode of action of wbcs types

mode of action of wbcs types

How are the male gametophytes formed in angiosperms, Q. How are the male ga...

Q. How are the male gametes and the male gametophytes formed in angiosperms? In the anthers of every stamen there are pollen sacs. Inside the pollen sacs there are microspore m

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd