phylum colentrata, Biology

Assignment Help:
In phylum colenterata if tissues are present in the body of an organism then why organs are not present as group of tissues makes an organuestion..

Related Discussions:- phylum colentrata

Types of asexual reproduction, TYPES OF ASEXUAL REPRODUCTION ...

TYPES OF ASEXUAL REPRODUCTION 1 . Binar y fission - Amoeba 2. Multipl e fission -

Distribution coefficient -terminology used in chromatography, Distribution ...

Distribution Coefficient - Terminologies used in Chromatography? During the purification or separation of the biomolecules it should be kept in mind that two important factors

Dicots, Dicots are one of the two main types of flowering plants; characte...

Dicots are one of the two main types of flowering plants; characterized by having two cotyledons, floral organs arranged in the cycles of four or five, and leaves with the reticul

Under which conditions aerobic cells carry out fermentation, Q. Under which...

Q. Under which conditions do aerobic cells carry out fermentation? Some cells that usually obtain energy from aerobic cellular respiration can perform fermentation when oxygen

Explain prosoma in details., Explain Prosoma in details. First tagma of...

Explain Prosoma in details. First tagma of a cheliciform consisting of the first six segments of the body. Appendages on the prosoma are involved in locomotion and feeding. Pro

Theory of embryology - regulative theory, REGUL A TIV E THEORY It...

REGUL A TIV E THEORY It was propounded by Hens Driesch. He performed experiments on the eggs of sea urchin similar to the experiments performed by Roux. He observed

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain mode of feeding, Normal 0 false false false EN-...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4 Mode of feeding

The klove roughness discrimination test, The Klove roughness Discrimination...

The Klove roughness Discrimination Test The subject must order four blocks covered with varying grades of sandpaper presented behind a blind with regards to degree of roughness

Flowering - development of plant, Flowering - Development of plant One...

Flowering - Development of plant One of the major changes that occur during the life cycle of a plant is the transition from vegetative stage to the flowering stage. In this t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd