Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define about the Carbohydrates? In the previous unit we have studied about the energy requirements. You now know that energy must be supplied regularly to individuals through t
Is it more indicated for a geneticist desiring to map the X chromosome of the mother of a given family (the researcher does not have access to her DNA, only access to the genetic m
what is the full name of Balfour in Balour''s law of cleavage?
F A TT Y ACIDS They are monocarboxylic organic acids (R.COOH) having a hydrocarbon chain of 4 - 30 carbon atoms. The polar carboxylic group is hydrophilic (Gk. hydro
list any 15 characteristics of phyla protozoa
What is a nutrient? A nutrient is it substance used in the metabolism and which is acquired from the diet. Such as, vitamins and necessary amino acids are nutrients.
Q. What is tubal pregnancy? Many times fecundation takes place in the Fallopian tubes in general the newly formed zygote is taken to the uterus where nidation and the embryonic
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are the special considerations required to be taken in maintenance of implants? The procedures for maintenance of patients with implants are similar to those with natural
Cellulose is a polysaccharide which is composed of the unbranched chains of glucose; the major structural carbohydrate of the plants, insoluble in water, and indigestible in the h
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd