Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Aim: To prove that oxygen is evolved during photosynthesis.
Apparatus: Beaker, funnel, test tube, water, Hydrilla plants.Procedure: Take a few pieces of Hydrilla plant. Keep a wide mouthed funnel into a beaker with water. Place the Hydrilla pieces inside the funnel. Carefully invert a test tube filled with water over the narrow end of the funnel. Keep the entire apparatus in sunlight for 2 to 3 hours.Observation: After some time you will observe small gas bubbles coming out of the leaves of Hydrilla. These bubbles collect at the end of the test tube. Collect more gas and then take out of the test tube by closing its mouth with the thumb. Test the gas by introducing glowing splinter. The splinter glows and burns more vigorously.Conclusion: From the above experiment, it is clear that oxygen is evolved during photosynthesis.Precautions:1. See that the twigs of Hydrilla plant are inside the funnel.2. while you are testing for oxygen, see that outside air does not enter test tube.3. For the experiment use only glass funnel and beaker.
Viscosity Viscosity, as you may already know, is associated with fluid flow. It is the internal friction which tends to bring to rest portions of the fluids moving relative to
Define Absorption, Storage and Elimination of Riboflavin? Riboflavin is absorbed from the small intestine through the portal vein and is passed to all tissues via general circu
Q. Are Fibrates effective at lowering TG levels? Fibrates are effective at lowering TG levels by 20 per cent to 50 per cent and raising HDL by 10-35 per cent. LDL reduction var
Define Functions of Calcium in Human Body? Calcium salts provide rigidity to the skeleton and calcium ions play a role in many if not most, metabolic processes. In the vertebra
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Most of the water taken up by a plant passes through it and is evaporated to the atmosphere. What use is made of the tiny fraction of this water which is retained by the plant?
Early campaigns of the 19th century that focused on sanitation, hygiene, housing, and nutrition had little effect in controlling communicable disease due to flawed rationale based
Explain the Aseptic Technique - Sub Culturing? Aseptic technique is a series of procedures used to prevent contamination of cultures and sterile culture media. It is one of the
Principle for Estimation of Percentage of Reducing and Total Sugar by Fehling Soxhlet Method? Reducing sugars are those which have free sugar groups and hence may be estimated
Planning of Nursing Care Provide supportive and symptomatic treatment. Provide bed rest. Encourage diet restriction, Implementation of Nursing Care
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd