Phospholipids - conjugated lipids, Biology

Assignment Help:

PHOSPHOLIPIDS

  • Most abundant lipid present in cell membrane, also called membrane lipid.
  • It is made up of lipid & phosphoric acid.
  • The basic phospholipid is phosphatidic acid.
  • They are respectively known as phosphatidylcholine (lecithin), phosphatidylethanolamine (cephalin), phosphatidylserine and phosphatidylinositol.
  • Phospholipids are amphipathic having both hydrophobic and hydrophilic ends.
  • Phospholipids also account for fluidity and selective permeability of membranes.
  • Lecithin acts as a carrier molecule, by its deficiency fatty liver disease is caused.
  • Cephalin present in egg yolk, nervous tissue.
  • Cephalin helpful in blood clotting.
  • Plasmogens present in brain & myelin sheath.
  • Sphingomyelin is a phospholipid, which do not contain glycerol.
  • Sphingosine is found, eg. nervous tissue.
  • Sphingomyelins occur in most animal membranes.
  • They are also present in good quantity in myelin sheath of nerve fibres.

Related Discussions:- Phospholipids - conjugated lipids

Gastropods - feeding and digestion in molluscs, Gastropods - Feeding and Di...

Gastropods - Feeding and Digestion in Molluscs In several gastropods the digestion is extracellular. Though, some herbivore gastropods like Crepidula are ciliary feeders and h

Nursing research, Definition: We  will  first define the term "Researc...

Definition: We  will  first define the term "Research" before  explaining the term Nursing Research. Research is a scientific process. It is defined as a systematic search for

Vegetative Development - Differentiation, Vegetative Development - Differen...

Vegetative Development - Differentiation It is referred to as qualitative changes that lead to increased specialisation. For example, the formation of cells and tissues of roo

Change of health status over time, Change of Health Status Over Time Hea...

Change of Health Status Over Time Health of a nation can be gauged from the available information on death.Disaggregated data by causes of death is more reflective of the status

Parthenocarpy, Parthenocarpy It is generally observed that the fruit d...

Parthenocarpy It is generally observed that the fruit develops after fertilization and it has fertile seeds inside it. However, this is not always so. Fruits of certain variet

Define the chemical fixation method, Define the Chemical Fixation Method? ...

Define the Chemical Fixation Method? Here chemical fixatives containing ethanol, acetic acid and formaldehyde etc. penetrates the cell and inactivates and immobilizes cellular

Discuss about brain, Brain Brain is a part of central nervous system wh...

Brain Brain is a part of central nervous system which lies in the skull. Source: Sears and Windwood, Anatomy and Physiology for Nurses The different parts of the bra

Describe metabolic acidosis and respiratory acidosis, Q. What is the differ...

Q. What is the difference between metabolic acidosis and respiratory acidosis and what is the difference between metabolic alkalosis and respiratory alkalosis? Respiratory acid

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd