Pharmacological management, Biology

Assignment Help:

Once the decision to start drug treatment of hypertension is made, the aim should be to provide 24 hour BP control, with agents that would encourage patient adherence. The patient and preferably, his family members must be educated about the disease, complications and treatment.

Since the treatment would be long term, great care should be taken to assess the patient's financial status and to tailor the investigations and the drugs suitably. It has been noted that very often, the home blood pressure instruments are either inaccurate or not used properly giving false results. So it is advisable to check on these factors if the patients are asked to do home monitoring.  

One of the usual statements made by patient is that when checked by another person, he found to have low BP or high BP. He should be asked to make a note of the exact readings obtained at that time.  

There are instances when patients claim that they felt that they had "pressure", when the truth was that he was going through a stressful period. Our practice is to warn the patient that the "pressure" he feels does not necessarily reflect high blood pressure.


Related Discussions:- Pharmacological management

Define vegetable as a rich source of protein, Define Vegetable as a rich so...

Define Vegetable as a rich source of protein? Fresh vegetables are not considered to be a very good source of proteins. On fresh weight basis, the average protein content of so

Formation of aqueous humour, Formation of Aqueous  Humour It  is  unive...

Formation of Aqueous  Humour It  is  universally accepted that the aqueous  is  produced  by  the  ciliary processes. Although a great deal of  research has been done on the fo

Pathology of mitral regurgitation, Q. Pathology of mitral regurgitation? ...

Q. Pathology of mitral regurgitation? During left ventricular systole as the pressure rises in left ventricle, blood is pumped simultaneously both into aorta and left atrium. T

Explain animal fats, Animal Fats This group consists of depot fats from...

Animal Fats This group consists of depot fats from domestic land animals (e.g., lard and tallow), all containing large amounts of C16 and C18 fatty acids, medium amounts of uns

Capital reserves, Capital Reserves 1. This is raised with selling shar...

Capital Reserves 1. This is raised with selling shares at a premium. As the difference among the market price less floatation costs and par value is credited to the capital re

Fibroblast, Fibroblast  is the term applied to a cell of connective tissue ...

Fibroblast  is the term applied to a cell of connective tissue which is separated from similar cells by some degree of the matrix material; fibroblasts secrete elastin and collagen

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Planning and implementation of nursing care - anaemia, Planning of Nursing ...

Planning of Nursing Care   The goals of nursing care are:  Administer oral iron supplements and parenteral iron therapy.  Provide nutritional counselling and educate t

Where do the photochemical stages of photosynthesis occur, Where do the pho...

Where do the photochemical and the chemical stages of photosynthesis occur? The photochemical stage of the photosynthesis process happens mainly on the thylakoids (the green pa

What is the photoperiod, What is the photoperiod? The Photoperiod is th...

What is the photoperiod? The Photoperiod is the daily time period of light exposure of a living being and the photoperiod may differ according to the period of the year.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd