Periodicity - qualitative characters, Biology

Assignment Help:

Periodicity (Phenology, Aspection)

It refers to the study of seasonal changes in the community, that is, the periodic phenomena of organisms in relation to their climate. Periodicity is a strongly fixed characters in plants. Different species of plants have different periods of seed germination, vegetative growth, flowering and fruiting, leaf fall, seed and fruit dispersal, and dissemination of seeds.

Such data for each species in a community is recorded. A study of the data and time of these events is termed as phenology. In other words, phenology is the calendar of events in the life history of a plant. Diagrammatic representation of such events is known as phenograms.


Related Discussions:- Periodicity - qualitative characters

Explain the maximum containment laboratory, >>>>Write a short note on the f...

>>>>Write a short note on the following- Question 1 Centrism in Bioethics Question 2 Bio Safety check list Question 3 Enforcement of IPRs Question 4 T

Osmoregulation in protozoans, Osmoregulation in Protozoans Osmoregulat...

Osmoregulation in Protozoans Osmoregulation or water balance in protozoa is accomplished by contractile vacuoles. One to several contractile vacuoles may be present within the

What is the main cell organelle involved in cell digestion, What is the mai...

What is the main cell organelle involved in cell digestion? What are the properties of that organelle that enable it to do the task? The organelles responsible for intracellula

Asymptomatic patient-chronic mitral regurgitation, Asymptomatic patient: ...

Asymptomatic patient: The current opinion is that in asymptomatic patients with left ventricular dysfunction and severe MR surgery should not be delayed. The echo cardiographic a

How are the fruits formed, How are the fruits formed? The fecundation i...

How are the fruits formed? The fecundation is in angiosperms triggers the release of hormones that act upon the ovaries. The ovary wall after that it develops into a fruit that

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Viruses, what is the basic structure of a virus?

what is the basic structure of a virus?

Explain the purpose of preparation of isolates from protein, Purpose of the...

Purpose of the preparation of isolates from a protein The major purpose of the preparation of concentrates and isolates from a protein source is to increase the concentration o

Systems of human body, Systems of Human Body Many organs work in a coo...

Systems of Human Body Many organs work in a coordinated'manner to form a system. For example in our-body the nose, the trachea and the lungs form the respiratory system. Table

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd