Pathogenesis, Biology

Assignment Help:

The interactions between the human host and selected microorganisms that culminate in IE involve the vascular endothelium, hemostatic mechanisms, the host immune system, gross anatomic abnormalities in the heart, surface properties of microorganisms, and peripheral events that initiate bacteremia. Endothelial damage results in platelet-fibrin deposition, which in turn is more receptive to colonization by bacteria than is the intact endothelium. It is hypothesized that platelet-fibrin deposition occurs spontaneously in persons vulnerable to endocarditis and that these deposits, called nonbacterial thrombotic endocarditis (NBTE) are the sites at which micro organisms adhere during bacteremia to initiate IE. Bacteremia is the initiating event that ultimately converts NBTE to IE.  Bacteremia rates are highest for events that traumatize the oral mucosa, particularly the gingiva, and progressively decrease with procedures involving the genitourinary tract and the gastrointestinal tract.

The platelet-thrombin deposits are found at the valve closure-contact line on the atrial surfaces of the mitral and tricuspid valves and on the ventricular surfaces of the aortic and pulmonic valves, the sites of infected vegetations in patients with IE. Three hemodynamic circumstances may injure the endothelium, initiating NBTE: (1) a high velocity jet impacting endothelium (2) flow from a high to a low pressure chamber and (3) flow across a narrow orifice at high velocity.  Flow through a narrowed orifice, as a consequence of venturi's effect, deposits bacteria maximally at the low-pressure sink immediately beyond an orifice or at the site where a jet stream impacts a surface.

To cause IE, the organism must be able to persist and propagate on the endothelium. This requires resistance to host defenses. The complement-mediated bactericidal activity of serum limits the ability of susceptible aerobic gram-negative bacilli to cause IE. Those organisms that most frequently cause endocarditis adhere more vigorously in vitro to cardiac valves than do organisms that rarely cause IE.


Related Discussions:- Pathogenesis

How different are the actions of antibodies against bacteria, How different...

How different are the actions of antibodies against bacteria and against virus? Why is the cellular immune response activated in case of chronic viral infection? The antibodies

Surgery for coronary artery disease, SURGERY FOR CORONARY ARTERY DISEASE : ...

SURGERY FOR CORONARY ARTERY DISEASE : Stenotic coronary artery disease (CAD) is caused by the thickening and narrowing of the coronary arteries (Atherosclerosis). Initially it cau

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine about the scales developed by golden, Determine about the scales ...

Determine about the scales developed by golden Several other scales have been developed by Golden and various collaborators, all of which are based on different ways of scoring

Define the term - the dna transistor, Regarding the article "The DNA Transi...

Regarding the article "The DNA Transistor" which of the following is a false statement? A. The DNA transistor refers to the use of an electrical sensor to read one nucleotide a

Female gametophyte, Female Gametophyte The development of a female gam...

Female Gametophyte The development of a female gametophyte is initiated with the enlargement of one of the megaspores (usually the one close to the chalaza in a linear tetrad)

How arab influence on the development of anatomy, Please on 3 separate para...

Please on 3 separate paragraph a. Examine the contributions of select scientists from the Greek and Roman period. b. Explore the Arab influence on the development of anatomy

Do plants placed under an environment drier than the habitat, Do plants pla...

Do plants placed under an environment drier than the habitat where they are used to living have a reduction or an increase in the time during which their stomata remain open? I

Define derived proteins - primary protein derivatives, Define Derived prot...

Define Derived proteins -  Primary Protein Derivatives? Derived proteins are the derivatives of the protein molecule, apparently fonned through hydrolytic changes in the molecu

Biogenesis of mitochondria, BIOGENESI S OF MITOCHONDRIA De Novo for...

BIOGENESI S OF MITOCHONDRIA De Novo formation i.e. new formation. It is not confirmed. New mitochondria are formed by division (Amitosis) of pre-existing mitochondria.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd