Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Osmotic Function - Essential Elements
Plant cells generally contain mineral ions 10 to 1000 times higher in concentration than the surrounding soil. That is why water enters the cells by osmosis and builds up turgor. You know that turgor maintains the shape and size of non-rigid plant parts such as leaves. Potassium is a key ion in this respect. Changes in its concentration in guard cells affect turgor and thus result in opening and closing of stomata. Turgor is also essential for the growth of plant cells.
Let us first learn about learn the points counsellor has to keep in mind for positive outcome of the counselling. The counsellor achieves the positive outcome of counselling, couns
Planning the Nursing Care 1) Maintain hydration and electrolyte balance. 2) Administer accurate and adequate antibiotics drugs. 3) Prevent the spread of infection.
Mitral Valve Replacement : When mitral valve replacement for a calcified, stenotic valve is done, usually it is a classical procedure removing leaflets, their chordae an
Define Iron Status of the Individual Lastly, iron status of the individual is a floury determinant of how much iron is absorbed. On a mixed diet with some haem iron, the overal
Define the Protective of Vitamin C role as an antioxidant? Vitamin C is a powerful antioxidant because it can donate a hydrogen atom and form a relatively stable ascorbyl free
Q. Medical and Nutritional Management for pectic ulcer? To provide physiological rest and support tissue healing, treatment should be based on providing rest to the affected ar
Fatty acid breakdown happens in the cytosol of prokaryotes in plants in peroxisomes and in the mitochondrial matrix of all other eukaryotes. By entering the mitochondrial matrix,
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is compensation point? What is the inference of the compensation point for the plant growth? The photic compensation point is the photic energy intensity under which ae
what is appendages in reptilia
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd