Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Osmotic and Ionic Regulation
The ammonotelism, ureotelism and uricotelism are the adaptations of the animals for the removal of toxic nitrogenous wastes and thereby maintain homeostasis. Animals regulate the concentration of water and salts in their body fluids in accordance with their external environment. The process of maintenance of osmotic concentration of the body fluids is called osmoregulation. Osmoregulation and excretion are intimately related as the ultimate aim of these processes is to maintain homeostasis. These processes are performed by the same set of organs. Kidney is the major organ of osmoregulation in vertebrates. Gills, integument, salt glands and rectal glands assist kidneys in this endeavour.
The osmoregulatory organs of invertebrates are nephridia, antenna glands and malpighian tubules. The cuticle of insects also performs an excellent osmoregulatory function in both aquatic and terrestrial insects. In this unit you shall study about the osmotic environments, osmotic exchanges between animal and the environment, the mechanisms used by various animals to cope up with environmental osmotic extremes and also about role of hormones in osmotic and ionic regulation.
What is the difference between embryo and endosperm?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Five Kingdom Classifications Biology, as you know, is the study of life, living things, and their relationship to one another and to their environment. This branch of Science
Explain Scope of Food Science and Technology as a Subject? Food science and technology has developed as a discipline to systematically organize and link various kinds of knowle
Define the Post-Herbal Period? It is difficult to draw a sharp line of demarcation between the transition period, marked by various attempts of classification, all of which we
advantages and disadvantages of protozoa
Q. What do you mean by Oxalates? Oxalates are widely distributed in plant foods mostly in the form of calcium salts. Oxalates are known to interfere with calcium absorpti
Adverse Effects The most common adverse effects of itraconazole are dose-related nausea and abdominal discomfort. Rash and serious hepatic toxicity can happen. The drug can ca
Trophic structure Organisms in a community are closely interrelated with each other through feeding relationships. Another aspect which is quite obvious in a community is th
what is a plasmid
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd