Osmotic and ionic regulation, Biology

Assignment Help:

Osmotic and Ionic Regulation

The  ammonotelism, ureotelism and uricotelism are the adaptations of the animals for the removal of toxic nitrogenous wastes and thereby maintain homeostasis. Animals regulate the concentration of water and salts in their body fluids in accordance with their external environment. The process of maintenance of osmotic concentration of the body fluids is called osmoregulation. Osmoregulation and excretion are intimately related as the ultimate aim of these processes is to maintain homeostasis. These processes are performed by the same set of organs. Kidney is the major organ of osmoregulation in vertebrates. Gills, integument, salt glands and rectal glands assist kidneys in this endeavour.

The osmoregulatory organs of invertebrates are nephridia, antenna glands and malpighian tubules. The cuticle of insects also performs an excellent osmoregulatory function in both aquatic and terrestrial insects. In this unit you shall study about the osmotic environments, osmotic exchanges between animal and the environment, the mechanisms used by various animals to cope up with environmental osmotic extremes and also about role of hormones in osmotic and ionic regulation.


Related Discussions:- Osmotic and ionic regulation

Embryo and endosperm, What is the difference between embryo and endosperm?

What is the difference between embryo and endosperm?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Five kingdom classifications, Five Kingdom Classifications Biology, as...

Five Kingdom Classifications Biology, as you know, is the study of life, living things, and their relationship to one another and to their environment. This branch of Science

Explain scope of food science and technology as a subject, Explain Scope of...

Explain Scope of Food Science and Technology as a Subject? Food science and technology has developed as a discipline to systematically organize and link various kinds of knowle

Define the post-herbal period, Define the Post-Herbal Period? It is di...

Define the Post-Herbal Period? It is difficult to draw a sharp line of demarcation between the transition period, marked by various attempts of classification, all of which we

Micro organisums, advantages and disadvantages of protozoa

advantages and disadvantages of protozoa

What do you mean by oxalates, Q. What do you mean by Oxalates? Oxalates...

Q. What do you mean by Oxalates? Oxalates are widely distributed in plant foods mostly in the form of calcium salts. Oxalates are known to interfere with calcium absorpti

Define adverse effect - itraconazole, Adverse Effects  The most common ...

Adverse Effects  The most common adverse effects of itraconazole are dose-related nausea and abdominal discomfort. Rash and serious hepatic toxicity can happen. The drug can ca

Trophic structure-structure of community, Trophic structure Organisms i...

Trophic structure Organisms in a community are closely interrelated with each other through feeding relationships. Another aspect which is quite obvious in a community is th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd