Osmoregulation in protozoans, Biology

Assignment Help:

Osmoregulation in Protozoans

Osmoregulation or water balance in protozoa is accomplished by contractile vacuoles. One to several contractile vacuoles may be present within the animal which may or may not have fixed sites in the cytoplasm and may have contributory canals or other vesicles opening into it.

These are water and ion regulating structures, acting as pumps to remove excess water from the cytoplasm. All freshwater protozoans have functioning systems of contractile vacuoles whereas, marine and parasitic forms have these less frequently.


Related Discussions:- Osmoregulation in protozoans

Gene targeting, Gene targeting: There is always a debate on gene integrat...

Gene targeting: There is always a debate on gene integration in to the host animal. It is random gene integration Vs gene targeting. Perhaps most significantly, pro-nuclear in

Landslides: measures to be taken during landslides, Protection of our prope...

Protection of our property:                  ·          If any our property lies in an area prone to landslides, we should seek advice of experts in earth movement and take cor

Which are the germ layers present in cnidarians, Q. Which are the germ laye...

Q. Which are the germ layers present in cnidarians? Which tissues of the animal do they originate? These beings present endoderm and ectoderm, two germ layers. Animals only wit

Phylum Coelenterata, Phylum Coelenterata characters anc classification

Phylum Coelenterata characters anc classification

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Cardio pulmonary bypass , CARDIO PULMONARY BYPASS  :  Open-heart surgery i...

CARDIO PULMONARY BYPASS  :  Open-heart surgery is considered as one of the most significant advances in medicine of 20th century. Establishment of safe cardio pulmonary bypass (CP

Meaning of diabetes self management education, Q. Meaning of Diabetes Self ...

Q. Meaning of Diabetes Self Management Education? You have learned that the treatment of diabetes depends upon the cooperation of the patient and also on how actively a patient

Domestic effluents - causes of water pollution, Domestic Effluents - Causes...

Domestic Effluents - Causes of Water Pollution Liquid waste produced daily in kitchen, bathroom and toilet are discharged directly or through canal, river or any other water b

Explain food intolerances, Food Intolerances Food Intolerances:  The in...

Food Intolerances Food Intolerances:  The intolerances of  the patient for specific food  items must be assessed. For example,  milk may lead  to diarrhoea  in some people whil

What is vegetarianism, What is Vegetarianism? Protein quality of the ...

What is Vegetarianism? Protein quality of the vegetarian diets can be improved by proper diet planning, However, under free-living conditions, vegetarianism can limit pr

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd