Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Osmoregulation in Protozoans
Osmoregulation or water balance in protozoa is accomplished by contractile vacuoles. One to several contractile vacuoles may be present within the animal which may or may not have fixed sites in the cytoplasm and may have contributory canals or other vesicles opening into it.
These are water and ion regulating structures, acting as pumps to remove excess water from the cytoplasm. All freshwater protozoans have functioning systems of contractile vacuoles whereas, marine and parasitic forms have these less frequently.
Gene targeting: There is always a debate on gene integration in to the host animal. It is random gene integration Vs gene targeting. Perhaps most significantly, pro-nuclear in
Protection of our property: · If any our property lies in an area prone to landslides, we should seek advice of experts in earth movement and take cor
Q. Which are the germ layers present in cnidarians? Which tissues of the animal do they originate? These beings present endoderm and ectoderm, two germ layers. Animals only wit
Phylum Coelenterata characters anc classification
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
CARDIO PULMONARY BYPASS : Open-heart surgery is considered as one of the most significant advances in medicine of 20th century. Establishment of safe cardio pulmonary bypass (CP
Q. Meaning of Diabetes Self Management Education? You have learned that the treatment of diabetes depends upon the cooperation of the patient and also on how actively a patient
Domestic Effluents - Causes of Water Pollution Liquid waste produced daily in kitchen, bathroom and toilet are discharged directly or through canal, river or any other water b
Food Intolerances Food Intolerances: The intolerances of the patient for specific food items must be assessed. For example, milk may lead to diarrhoea in some people whil
What is Vegetarianism? Protein quality of the vegetarian diets can be improved by proper diet planning, However, under free-living conditions, vegetarianism can limit pr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd