Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
. Explain why the traditional classification of unicellular eukaryotes as ‘protozoa’ or ‘protists’ is invalid in terms of modern systematics and evolutionary theory. Why are trad
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain in brief about the diseases Sleep paralysis This is an episode of paralysis in the transition between wakefulness and sleep. The period of paralysis is usually brief bu
Conjugated Proteins Conjugated proteins are composed of easy proteins combined with a non- proteinous substance. The non-proteinous substance is known as prosthetic group o
What is the meaning of Ideometric approach Ideometric approach in the context of neuropsychological assessment emphasises the patient's premorbid functioning with reference to
Why does bark often die and break naturally? The bark is the mature periderm of the stem, branches and roots. It dies and breaks when these structures grow and thus the perider
Define National Iodine Deficiency Disorder Control Programme (NIDDCP)? The prevalence of iodine deficiency disorders (IDD) are seen more among adolescent's young adults and sc
Q. Causes of Malnutrition in Inflammatory Bowel Disease? The causes of malnutrition include: • Decreased oral intake, which can be disease induced due to abdominal pain, dia
That is eutrophication? Explain with reference to aquatic ecosystem. or Name any two source organisms of agar. List any four areas in which agar has wide application.
CYTOCHEMISTR Y OF PROTOPLASM - It is supper mixture or mixture of mixtures . 3 4 elements present in it. 1 3 elements are universal. e.g. C, H, O, N, P, K, S,
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd