ORGANIC MANUres, Biology

Assignment Help:
why manures are better than fertilizers

Related Discussions:- ORGANIC MANUres

Taxonomy, . Explain why the traditional classification of unicellular euka...

. Explain why the traditional classification of unicellular eukaryotes as ‘protozoa’ or ‘protists’ is invalid in terms of modern systematics and evolutionary theory. Why are trad

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain in brief about the diseases sleep paralysis, Explain in brief about...

Explain in brief about the diseases Sleep paralysis This is an episode of paralysis in the transition between wakefulness and sleep. The period of paralysis is usually brief bu

Explain about conjugated proteins, Conjugated Proteins Conjugated prote...

Conjugated Proteins Conjugated proteins are composed of easy proteins combined with a non- proteinous substance.  The non-proteinous substance is known as prosthetic group o

What is the meaning of ideometric approach, What is the meaning of Ideometr...

What is the meaning of Ideometric approach Ideometric approach in the context of neuropsychological assessment emphasises the patient's premorbid functioning with reference to

Why does bark often die and break naturally, Why does bark often die and br...

Why does bark often die and break naturally? The bark is the mature periderm of the stem, branches and roots. It dies and breaks when these structures grow and thus the perider

Define national iodine deficiency disorder control programme, Define Nation...

Define National Iodine Deficiency Disorder Control Programme (NIDDCP)? The prevalence of iodine deficiency disorders (IDD) are seen more among adolescent's young adults and sc

Causes of malnutrition in inflammatory bowel disease, Q. Causes of Malnutri...

Q. Causes of Malnutrition in Inflammatory Bowel Disease? The causes of malnutrition include: • Decreased oral intake, which can be disease induced due to abdominal pain, dia

Explain with reference to aquatic ecosystem, That is eutrophication? Explai...

That is eutrophication? Explain with reference to aquatic ecosystem. or Name any two source organisms of agar. List any four areas in which agar has wide application.

Cytochemistry of protoplasm, CYTOCHEMISTR Y OF PROTOPLASM - It is ...

CYTOCHEMISTR Y OF PROTOPLASM - It is supper mixture or mixture of mixtures . 3 4 elements present in it. 1 3 elements are universal. e.g. C, H, O, N, P, K, S,

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd