Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
OPEN HEART SURGERY : When patient is connected lo cardio pulmonary bypass for an operative procedure, it is considered to be open-heart operation. In a routine coronary artery bypass, no cardiac chamber is opened. Yet, as the patient is connected to heart lung machine and heart is stopped, it is considered as open-heart surgery.
how?
Define Role of Nutrients in Controlling Gene Expression? The role of several nutrients in controlling gene expression, as mentioned earlier, is in infancy, but with advancing b
Factors affecting the process of deep fat frying. The common factors influencing the process of deep frying include: 1. Heat- Frying temperatures ranging from 150 -190°C
types of enzyme
Q. What is predatism? The Predatism is the ecological interaction in which one individual kills or mutilates another to get food. The Predatism is an inharmonious (negative) ec
Define drug effects on food intake - cause dry mouth? cause dry mouth (xerostomia) : Lack of saliva makes it difficult to masticate and swallow foods, especially those of a dry
How does iodine kill germs? The microbiocidal action of Iodine is because of the active form, I2, which is polarized by water and like all halogens (chlorine, fluorine, bromine
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the Protein Efficiency Ratio (PER)? PER method was developed by Osborne, Mendel and Ferry in 1919 and is based on the growth of young rats. The diets usually contain 10
What are some examples of biological activities in which osmosis plays an important role? Hemolysis (destruction of red blood cells) by entrance of water, the hydric regulation
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd