Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Open Heart Surgery
These surgeries are done under alternative arrangements to continue oxygenated systemic blood supply, while the heart is operated on (Cardiopulmonary bypass).
Common open heart surgeries are:
Mitral stenosis
Open mitral valvotomy or commissurotomy
Removal of thrombi from atrium and its appendage
Commissure incision, separation of fused chordae
Splitting of underlying papillary muscle, and debriding the valve of calcium.
Mitral regurgitation
Annuloplasty Reconstruction of the valve leaflets and the annulus
Tricuspid regurgitation
With or without the aid of prosthetic rings (carpentier ring).
Diagnostic Procedures Taking Clinical history Urine analysis Blood sample for estimation of blood urea nitrogen Antistrepto lysine (ASO) titer
poor skin turgor js indicative of what
Ooplasmic Determinants and Somatic Cell Determination Eggs of tunicates go through typically mosaic development in which the various blastomeres become determined to follow th
1. A pure-breeding black, smooth guinea pig was mated to a pure-breeding white, rough female. They produced several litters, and eventually, five males and twenty females resulted
Explain Elephant Trunk Technique in Aortic Aneurysm ? Elephant Trunk Technique : When aneurysm involves arch of the aorta and large portion of descending thor
What might happen to membranes if many -OH groups were added to the tails of phospholipids?
There are three methods of collections: 1. Kerbside collection: In this collection system the refuse is brought in containers and placed on the footway, from where it is
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Infectious laryngotracheitis (ILT) Infectious laryngotracheities, caused by fowl Gallid Herpesvirus 1 belonging to the family Herpesviridae, is a quickly spreading acute res
Explain the Advantages of Double Beam Method? The double beam method has advantage over single beam as it automatically corrects, for the change in light transmission, through
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd