Open heart surgery , Biology

Assignment Help:

Open Heart Surgery

These surgeries are done under alternative arrangements to continue oxygenated systemic blood supply, while the heart is operated on (Cardiopulmonary bypass).

Common open heart surgeries are:

Mitral stenosis

Open mitral valvotomy or commissurotomy 

Removal of thrombi from atrium and its appendage

Commissure incision, separation of fused chordae

Splitting of underlying papillary muscle, and debriding the valve of calcium.

Mitral regurgitation

Annuloplasty Reconstruction of the valve leaflets and the annulus

Tricuspid regurgitation

With or without the aid of prosthetic rings (carpentier ring).


Related Discussions:- Open heart surgery

Diagnostic procedures for acute glomerulonephritis, Diagnostic Procedures ...

Diagnostic Procedures     Taking Clinical history    Urine analysis    Blood sample  for  estimation  of blood urea nitrogen    Antistrepto lysine  (ASO) titer

Ooplasmic determinants and somatic cell determination, Ooplasmic Determinan...

Ooplasmic Determinants and Somatic Cell Determination Eggs of tunicates go through typically mosaic development in which the various blastomeres become determined to follow th

Phenotypic classes, 1. A pure-breeding black, smooth guinea pig was mated t...

1. A pure-breeding black, smooth guinea pig was mated to a pure-breeding white, rough female. They produced several litters, and eventually, five males and twenty females resulted

Explain elephant trunk technique in aortic aneurysm, Explain Elephant Trunk...

Explain Elephant Trunk Technique in Aortic Aneurysm ? Elephant Trunk Technique :  When aneurysm involves arch of the aorta and large portion of descending thor

What will happen to membranes, What might happen to membranes if many -OH g...

What might happen to membranes if many -OH groups were added to the tails of phospholipids?

collection of solid waste, There are three methods of collections: 1.  ...

There are three methods of collections: 1.      Kerbside collection: In this collection system the refuse is brought in containers and placed on the footway, from where it is

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Poultry and duck diseases-infectious laryngotracheitis (ilt), Infectious la...

Infectious laryngotracheitis (ILT) Infectious laryngotracheities, caused by fowl Gallid Herpesvirus 1 belonging to the family Herpesviridae, is a quickly spreading acute res

Explain the advantages of double beam method, Explain the Advantages of Dou...

Explain the Advantages of Double Beam Method? The double beam method has advantage over single beam as it automatically corrects, for the change in light transmission, through

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd