Oogenesis, Biology

Assignment Help:

- Oogenesis involves the formation of haploid cells from an original diploid cell, called a primary oocyte, through meiosis.

- The female ovaries contain the primary oocyte. There are two major differences between the male and female production of gametes. First of all, Oogenesis only leads to the production of one final ovum, or egg cell, from each primary oocyte (in contrast to the four sperm that are generated from every spermatogonium).

- Of the four daughter cells that are produced when the primary oocyte divides meiotically, three come out much smaller than the fourth. These smaller cells, called polar bodies, eventually disintegrate, leaving only the larger ovum as the final product of Oogenesis. The production of one egg cell via Oogenesis normally occurs only once a month, from puberty to menopause.

1581_Oogenesis.png


Related Discussions:- Oogenesis

Bile acid sequestrants for coronary prevention, These are safe and free of ...

These are safe and free of systemic side effects. However, gastrointestinal side effects are common, and compliance is poor. The average LDL decreases by approximately 15 per cent

Discuss about the luria nebraska procedure, Discuss about the Luria Nebrask...

Discuss about the Luria Nebraska procedure The Luria Nebraska procedure involves an age and education correction. It is accomplished by computation of a cutoff score for abnorm

What is microtubule assembly, Microtubule assembly: A) generally originates...

Microtubule assembly: A) generally originates in the centrosome. B) Occurs only during mitosis. C) Occurs randomly throughout the cell. D) Is regulated by myosin. E) Is inhibited d

What is the meaning of term - plasticity, What is the meaning of term - Pla...

What is the meaning of term - Plasticity The notion of brain plasticity has been of interest to researchers and clinicians alike for decades. The outcome of injury is the resul

Bovine ephemeral fever, B o v i ne ephemeral fever Ephemeral fever ...

B o v i ne ephemeral fever Ephemeral fever is commonly known as 'three-day sickness'. It affects mainly cattle and occasionally sheep in India. Causative agent is a mosquit

What are the main sources of mercury pollution, What are the environmental ...

What are the environmental harms caused by mercury pollution? What are the main sources of mercury pollution? Mercury is a metal that when present in the water of lakes, river

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain homogenization, Explain Homogenization Homogenized milk will n...

Explain Homogenization Homogenized milk will not be affected, as the fat globules are already broken up.  Homogenization increases the viscosity of whole milk but slightly dec

How to planning the daily diet for underweight patients, How to Planning th...

How to Planning the Daily Diet for Underweight Patients? As mentioned above you need to add calories gradually to the diet. A practical way of doing so is to take the present i

Relation of water content to functions, Relation of Water Content to Functi...

Relation of Water Content to Functions If an aquatic plant appearing turgid is removed from water and left in the open, it quickly wilts. The water content of the leaves may

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd