Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Oogenesis
Oogenesis is the formation of ovum from oogonial cells that are formed in the ovary from primordial germ cells. And as in spermatogenesis it involves meiosis to produce haploid ovum. You have learnt in the section on spermatogenesis that the differentiation of sperm occurs after the meiotic events. In oogenesis the process of first meiotic division is very prolonged; and it is during this process that growth and differentiation of oocyte take place. In many animals most events related to oocyte differentiation occur during prophase I of first meiotic division. In animals which produce yolk-laden eggs, this phase is divided into
Vitamin B 12 (Cyanocobalamin) Vitamin B 12 refers to a group of Cobalt-containing corrinoids known as cobalamins. It is also called antipernicious- anemia factor, extrinsic f
Determination of Nicotinic acid The chemical methods of assay are based on colour reactions of pyridine. Nicotinic acid and nicotinamide are converted by cyanogen bromide into
Nuclear transport is an energy-dependent process mediated through saturable receptors. Export and Import receptors are by to distinguish and bind to nuclear localization signals or
Describe the events which lead to the formation of (a) identical twins, (b) fraternal twins. (a) Identical twins are derived from the products of a one zygote which separa
What are age pyramids? Age pyramids are graphical representations in form of superposed rectangles every representing the number of individuals contained in age ranges into whi
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Fats requirement in chronic diarrhoea? Total amount of fat may be restricted as its digestion and absorption is compromised. In order to increase on the calorie density of t
History Past and present history of cardiovascular problems of patient & family. History of chest pain, shortness of breath, fatigue, abnormal skin colour, dizziness, vertigo
Legume - Development of seeds Outer epidermis of the ovary usually forms the exocarp of the leguminous pod. Next few cell layers constitute the mesocarp with thick-walled pare
MAJOR EVENTS DURING GASTRULATION - 1. There is rearrangement of cells due to morphogenetic movement of the cells of blastoderm. 2. The three primary germ layer g
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd