Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Oogenesis
Oogenesis is the formation of ovum from oogonial cells that are formed in the ovary from primordial germ cells. And as in spermatogenesis it involves meiosis to produce haploid ovum. You have learnt in the section on spermatogenesis that the differentiation of sperm occurs after the meiotic events. In oogenesis the process of first meiotic division is very prolonged; and it is during this process that growth and differentiation of oocyte take place. In many animals most events related to oocyte differentiation occur during prophase I of first meiotic division. In animals which produce yolk-laden eggs, this phase is divided into
Q. Explain Diseases of pericardium? Pericardium is the sac covering the heart. Pericardium consists of two layers-the visceral pericardium (epicardium) and the parietal pericar
Q. What do you know about Tricuspid stenosis? It is rare disease, with rheumatic etiology seen in 90 per cent of cases. In patients with rheumatic mitral stenosis only 3-5 per
A 21-year-old woman presents with a 3-month history of malaise, joint pain, weight loss, and sporadic fever. Her temperature is 38°C (101°F). The serum antinuclear antibody (ANA) t
Copper Copper is an essential trace element required for enzyme systems, iron metabolism, connective tissue metabolism, integrity of the central nervous and immune systems. Co
Classification of the Phylum Protozoa up to orders
Ask question #Minimum cell theory 100 words accepted#
Uses of Hydrocolloidsfor health Hydrocolloids, together with other dietary fibres are increasingly being seen as contributing to a number of health effects. Some of the hydroco
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Water loss during excretion In terrestrial animals body water is also lost during excretion of nitrogenous wastes. A number of physiological adaptations have taken place to mi
Explain Associated Mitral Regurgitation and their role in miscellaneous conditions? Normal 0 false false false EN-IN X-NONE X-NONE
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd