Off pump surgery , Biology

Assignment Help:

OFF PUMP SURGERY :  In spite of great advancements in techniques of cardio pulmonary bypass, it is still not physiological. There can be various complications related to perfusion. Off pump surgery is based on the principle that if a safe operation can be done on a beating heart without sacrificing the quality or surgery, it will be beneficial to the patient.

 


Related Discussions:- Off pump surgery

Fluid mosaic model, FLUI D MOSAIC MODEL Proposed by Nicholson and ...

FLUI D MOSAIC MODEL Proposed by Nicholson and Singer (1972) Proteins and lipids are arranged in a mosaic fashion. Lipids and proteins are in a semi fluid structure.

Use of computer in biotechnology, what are the uses of computer in biotechn...

what are the uses of computer in biotechnology ??? briefly explain any twenty

Which functional groups ionization stabilized by resonance, In which of the...

In which of the following functional groups ionization is stabilized by resonance? Select one: a. Carboxyl b. Hydroxyl c. Amine d. Aldehyde e. All of the above

How can the binding of two amino acids, Q. How can the binding of two amino...

Q. How can the binding of two amino acids for the peptide formation be explained? A peptide is formed when a carbon from the carboxyl group of one amino acid is connected to th

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain adverse effects of cidofovir, Explain Adverse Effects of Cidofovir ...

Explain Adverse Effects of Cidofovir About 25% of patients discontinue cidofovir because of adverse effects such as nephrotoxicity, neutropenia and metabolic acidosis. Iritis,

Of which substance are microtubules made, Of which substance are microtubul...

Of which substance are microtubules made? In which structures and cellular processes do microtubules participate? Microtubules are made of consecutive dimers of the protein tub

Nerve fibres, NERV E FIBRES - Axon or dendrite of a nerve cell cove...

NERV E FIBRES - Axon or dendrite of a nerve cell covered with one, two or three sheaths is called nerve fibre. Dendrites are surrounded only by one sheath. An axon may b

Define the cooper''s run (12 minute run) method, Define the Cooper's Run (1...

Define the Cooper's Run (12 minute run) Method? To undertake this test, a 400 metre running track is required-marked every 100 m and a stop watch. The test comprises of noticin

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd