Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The NYQUIST LIIMIT-It is a sampling phenomenon, which limits the maximum fiequemcy shift measurement to one half of the sampling frequency (PRF).
By its nature, pulse wave Doppler is a sampling system while continuous wave Doppler is not. The nyquist limit is a theoretical maximum frequency that a
If the frequency shift is higher than the Nyquist frequency, aliasing occurs; i.e., the Doppler spectrum is cut off the Nyquist frequency and the remaining frequency shift is recorded on the opposite side of baseline.
The PRF varies inversely with the depth of the sample volume the shallower the location of the sample volume, the higher the PRF and Nyquist frequency. In other words, higher velocities can be recorded without aliasing by pulse wave Doppler if the sample volume is closer to transducer.
Q. Complications of short bowel syndrome? Complications of short bowel syndrome are generally related to malnutrition. What are the complications of malnutrition? A person with
mitochondria?
Green leaves make food for plants Heat some alcohol in a jar over boiling water unless it boils. Break various green leaves from a geranium or other plant which has been in the
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. How the DNA nanoarchitecturing works? DNA Nano architectures constructs that can be self-assembled from branched DNA molecules. Their components can be simple branched speci
Explain The absorption of itraconazole capsules It is decreased with concurrent use of drugs that reduce gastric acidity, such as antacids, H2-receptor blockers, proton pump in
Stress - Responses of Plants to Stress Let us recall what happens within the natural communities occupying the same habitat. The relative location of two plants may place them
Radiology is a medical specialty that employs the use of imaging to both diagnose and treat disease visualised within the human body. Radiologists use an array of imaging technolog
The following are the important neuropathic symptoms: 1. Dysesthesia: It means burning or tingling sensation, sunburn like feeling etc. Take a note of duration, time of occurre
what is the classification of poisonous arthropods according to their mode of toxicity to human
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd