Nyquist limit, Biology

Assignment Help:

The NYQUIST LIIMIT-It is a sampling phenomenon, which limits the maximum fiequemcy shift measurement to one half of the sampling frequency (PRF).

By its nature, pulse wave Doppler is a sampling system while continuous wave Doppler is not. The nyquist limit is a theoretical maximum frequency that a

If the frequency shift is higher than the Nyquist frequency, aliasing occurs; i.e., the Doppler spectrum is cut off the Nyquist frequency and the remaining frequency shift is recorded on the opposite side of baseline.

The PRF varies inversely with the depth of the sample volume the shallower the location of the sample volume, the higher the PRF and Nyquist frequency. In other words, higher velocities can be recorded without aliasing by pulse wave Doppler if the sample volume is closer to transducer.

438_NYQUIST LIMIT.png


Related Discussions:- Nyquist limit

Define the sterilization protocol, Define the Sterilization protocol? S...

Define the Sterilization protocol? Sterilization protocol encompasses the following: 1. Transport of instruments to the sterilization area 2. Cleaning of instruments 3

What is rationale for menu planning, What is Rationale for Menu Planning? ...

What is Rationale for Menu Planning? 'Menu', as we all know, is nothing but a list of dishes planned for preparation, and forms the very core of all activities in the food serv

What is the main theory opposed to evolution, What is the main theory oppos...

What is the main theory opposed to evolution? The major theory that opposes the evolution theory on the description of how species emerged (phylogenesis) is fixism.

Define the functions of vitamin a, Define the Functions of Vitamin A? V...

Define the Functions of Vitamin A? Vitamin A (retinol) is an essential nutrient needed in small amounts by humans for the normal functioning of the visual system, growth and de

Control of noise pollution, Following ways can be used for control of noise...

Following ways can be used for control of noise pollution: It can be controlled by designing, fabricating and using quiter machines. In heavy industries, sound proof insul

Stages of wilms tumour , Stages of Wilm's tumour  We shall now discuss...

Stages of Wilm's tumour  We shall now discuss about the various stages of Wilm's tumour. The extent of  disease is staged according to the findings of  surgery and  the presen

Discuss the evolution of implants in dentistry, Q. Discuss the evolution of...

Q. Discuss the evolution of implants in dentistry? The first use of Implants dates back to 600 A.D. in the Mayan population where intraosseous implantation of animal teeth or t

Do plants present only sexual reproduction, Q. Do plants present only sexua...

Q. Do plants present only sexual reproduction? There are asexual forms of reproduction in plants few naturally detached pieces of root, leaves or limbs develop into another com

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Acute renal failure and its etiology, Acute Renal Failure You know tha...

Acute Renal Failure You know that acute renal failure refers to the sudden deterioration in kidney function, characterised by reduced urine excretion to less than 10 ml/kg  bo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd