nutrition, Biology

Assignment Help:
nutrition in paramecium

Related Discussions:- nutrition

How do the repairing enzymes of the genetic system act, How do the repairin...

How do the repairing enzymes of the genetic system act? There are enzymes within the cells that detect errors or alterations in DNA molecules and start a repair of those errors

What is sympatric isolation, A few individuals from a herd of deer are forc...

A few individuals from a herd of deer are forced to migrate to a new herd. This is an example of  resulting in.   a.  Gene flow; enhance in similarities between populations.

Chronic aortic regurgitation-types of regurgitation, Chronic Aortic Regurgi...

Chronic Aortic Regurgitation :  The aetiological factors leading to aortic regurgitation are: (1) rheumatic, (2) annulo aortic ectasia, (3) native valve endocarditis, (4) c

Illustrate the composition of agar, Composition of agar Agar we learnt ...

Composition of agar Agar we learnt consists of a mixture of agrose and agropectin.  Agrose has a linear polymer structure  consisting of alternating D-galactose and 3,6-anhydro

Explain the role of solutions, Explain the role of solutions? Solution...

Explain the role of solutions? Solutions:  A solution consists of a liquid solvent plus substances dissolved in it, called solutes. Solutes may be ions, atoms, or small molec

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Can you explain about thoracic aortography, Q. Can you explain about thorac...

Q. Can you explain about thoracic Aortography? Aortic arch angiography has been used to assess aortic valve or aortic root disease. Thoracic aortography is helpful for assessm

Define about the chemotherapy, Define about the Chemotherapy - Cancer? ...

Define about the Chemotherapy - Cancer? Chemotherapy results in lot of side effects. This is because the drug effects are not specific to cancer cells alone. Even the host cell

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd