Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Nutrition
As we have said earlier all animals are heterotrophs and require food from the environment. What is this food made up of? If the food of a number of different animals is broken down we find that it consists of proteins, carbohydrates, fats, water, minerals and vitamins. All animals require the above-mentioned broad categories of nutrients although in different amounts.
Some of these nutrients are used mainly as fuel (carbohydrates and fats), while others are required principally as structural and functional components (proteins, minerals and vitamins). However, proteins, carbohydrates and fats can all serve as fuel for the body's energy needs, but no animal can survive on fuels alone. Therefore, a balanced diet is needed to meet all the requirements of the body for energy, growth, maintenance, reproduction and physiological regulation. Now let us discuss the importance of these different classes of food in relation to animal nutrition.
write about complementary genes
"Diversity is good" is one of the axioms of conservation biology. However in absentia of historical information, why is noting higher diversity in a system NOT the best way to eval
Define Disadvantages of Direct Microscopic Count? 1. Small cells are difficult to see under the microscope and may be missed. 2. It gives total count, i.e., both live and de
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain about the cyclamate - artificial sweeteners? Another sweetener is cyclamate (sodium cyclohexylsulphamate). Have a look at its structure as shown in the figure. It is on
Protease inhibitors (PIs) Protease inhibitors prevent cleavage of protein precursors essential for HIV maturation, infection of new cells and viral replication. Use of a prote
Q. What do you mean by Descending Aorta? The descending aorta begins at the level of the fourth thoracic vertebra. It is defined through the cardiac shadow on the CXR, as it l
Assessment of Peripheral Vascular Perfusion (Beside Test) Burger's Postural Test Perform in daylight. Place patient supine with both legs elevated and knees
Give three examples of diseases caused by bacteria, Diseases caused by bacteria contain tonsillitis, blood poisoning, scarlet fever, tuberculosis, typhoid, diphtheria, food poi
Define nutritional needs During Recovery? Here, let us discuss what should be the nutritional goals based on the physiological aspects involved. Goals: The main emphasis mus
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd