Nutrition, Biology

Assignment Help:

Nutrition

As we have said earlier all animals are heterotrophs and require food from the environment. What is this food made up of? If the food of a number of different animals is broken down we find that it consists of proteins, carbohydrates, fats, water, minerals and vitamins. All animals require the above-mentioned broad categories of nutrients although in different amounts.

Some of these nutrients are used mainly as fuel (carbohydrates and fats), while others are required principally as structural and functional components (proteins, minerals and vitamins). However, proteins, carbohydrates and fats can all serve as fuel for the body's energy needs, but no animal can survive on fuels alone. Therefore, a balanced diet is needed to meet all the requirements of the body for energy, growth, maintenance, reproduction and physiological regulation. Now let us discuss the importance of these different classes of food in relation to animal nutrition.


Related Discussions:- Nutrition

Genetics , write about complementary genes

write about complementary genes

Compare different communities for conservation purpose, "Diversity is good"...

"Diversity is good" is one of the axioms of conservation biology. However in absentia of historical information, why is noting higher diversity in a system NOT the best way to eval

Define disadvantages of direct microscopic count, Define Disadvantages of D...

Define Disadvantages of Direct Microscopic Count? 1. Small cells are difficult to see under the microscope and may be missed. 2. It gives total count, i.e., both live and de

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about the cyclamate - artificial sweeteners, Explain about the cycl...

Explain about the cyclamate - artificial sweeteners? Another sweetener is cyclamate (sodium cyclohexylsulphamate). Have a look at its structure as shown in the figure. It is on

Explain protease inhibitors, Protease inhibitors (PIs) Protease inhibi...

Protease inhibitors (PIs) Protease inhibitors prevent cleavage of protein precursors essential for HIV maturation, infection of new cells and viral replication. Use of a prote

What do you mean by descending aorta, Q. What do you mean by Descending Aor...

Q. What do you mean by Descending Aorta?  The descending aorta begins at the level of the fourth thoracic vertebra. It is defined through the cardiac shadow on the CXR, as it l

Assessment of peripheral vascular perfusion (beside test), Assessment of Pe...

Assessment of Peripheral Vascular Perfusion (Beside Test) Burger's Postural Test Perform in daylight.  Place patient supine with both legs elevated and knees

Give examples of diseases caused by bacteria, Give three examples of diseas...

Give three examples of diseases caused by bacteria, Diseases caused by bacteria contain tonsillitis, blood poisoning, scarlet fever, tuberculosis, typhoid, diphtheria, food poi

Define nutritional needs during recovery, Define nutritional needs During R...

Define nutritional needs During Recovery? Here, let us discuss what should be the nutritional goals based on the physiological aspects involved. Goals: The main emphasis mus

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd