Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Nutrition
As we have said earlier all animals are heterotrophs and require food from the environment. What is this food made up of? If the food of a number of different animals is broken down we find that it consists of proteins, carbohydrates, fats, water, minerals and vitamins. All animals require the above-mentioned broad categories of nutrients although in different amounts.
Some of these nutrients are used mainly as fuel (carbohydrates and fats), while others are required principally as structural and functional components (proteins, minerals and vitamins). However, proteins, carbohydrates and fats can all serve as fuel for the body's energy needs, but no animal can survive on fuels alone. Therefore, a balanced diet is needed to meet all the requirements of the body for energy, growth, maintenance, reproduction and physiological regulation. Now let us discuss the importance of these different classes of food in relation to animal nutrition.
Guanine is one of the nitrogenous bases in the nucleic acids, guanine is one of the two purine bases.
ROLE OF PSYCHIATRIC NURSE: In Blocks 2 and 3 you have learnt about various therapeutic interventions for mental disorders like anxiety neurotic disorders, psychotic disorder
Assume that you have 1M stock solutions of NaCl, KCl, and CaCl2. If the ion concentrations in human plasma are 120 mM Na+, 12mM K+, and 2 mM Ca+, compute the volumes of the stock s
what the advantage of yersinia pestis
what is vaso-constriction
A population has 350 births per 1000 individuals and 320 deaths per 1000 individuals. 1. what its population growth rate? 2. Intrinsic rate of increase? 3. Doubling time? 4. Derive
Sedge-Meadow Stage - Hydrarch Favoured by an increasing amount of light, as the former occupants disappear, they gradually change the reed swamp into a sedge meadow. And now s
Define the role of riboflavin in Antioxidant Activity? Flavoproteins also have powerful antioxidant activity from their role as precursors to FMN and FAD. Among the FAD-requiri
What is Colloids and Suspensions ? Colloids and Suspensions : Colloids and suspensions are mixtures in which larger particles replace solutes. Colloids, or colloidal suspe
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd