Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Buffers and Buffer Solutions? Solutions containing both weak acid and their salts or solutions containing weak hydroxides and their salts are referred to as buffer solut
What food items include in full liquid diet - Soups and broths - Cereal porridges (refined cereals) - Milk and milk beverages, yoghurt - Coffee, tea, fruit juices
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Field Capacity (FC) It is the capacity of a field to hold the amount of water against gravitational forces. It is expressed as the percentage of the dry weight of the soil. Fi
Q. Can Serotonin used in consciousness? Serotonin complements the action of noradrenalin and acetylcholine in promoting wakefulness and cortical responsiveness. Experiments pro
Q Under which environments do echinoderms live? Echinoderms are marine animals and they live in salt water.
Types of Neural networks Neural networks can be grouped into: Sensory filter networks that are organised so as to pass on only certain features of a complex senso
Determinants of Health Status The linkage between economic development and health was discussed in the previous unit. The present unit deals with an identification of the factor
give a detail account of modes of locomotion in protozoa
Describe the significance of micronucleus. One of two types of dimorphic nuclei found in ciliate protozoans. The single micronucleus contains only one copy of the genome and is
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd