Nursing process - bronchial asthma, Biology

Assignment Help:

Nursing Process

Assessment

History, precipitating factors, current medication, medication used to relieve asthma symptoms. Any recent changes in medication regimen. Self-care methods used to relieve symptoms.

Physical Examination

  1. General appearance-apprehensive, sensorium, altered or not. 
  2. Vitals: Tachycardia, Tachypnea, pulses paradoxus 

Pulmonary Examination

  1. Use of accessory muscles to breath. 
  2. Posture-forward breathing. 
  3. Dyspnea 
  4. Prolonged expiration 
  5. Cynosis 
  6. Decreased lateral expansion 
  7. Decreased tremitus 
  8. Hyperresonance 
  9. Decreased diaphragmatic excursion 
  10. Inspiratory and expiratory wheezing 
  11. Rhonchi (as patient gets exhausted due to dyspnea, breath sounds and adventious founds may be absent or faint).

Related Discussions:- Nursing process - bronchial asthma

What is osmotic pressure, Osmotic pressure is the pressure formed in a aque...

Osmotic pressure is the pressure formed in a aqueous solution by a region of lower solute concentration upon a region of superior solute concentration forcing the passage of water

Define the xtensor motor neurons, Which of the following occur in response ...

Which of the following occur in response to an increase in the length of the right knee extensors in response to a quick tap applied to the right patellar tendon?  An increase in t

How can the formation of egg cells from germ cells, Indicating the name and...

Indicating the name and respective ploidy of each involved cell how can the formation of egg cells from germ cells be described? The formation of egg cells starts with a germ c

Difference between carriers of hiv and aids patients, What is the differenc...

What is the difference between carriers of HIV and AIDS patients? A person can be a carrier of the HIV without necessarily being affected by the immunodeficiency syndrome at t

Explain the class reptilia perform gas, Do beings of the class Reptilia per...

Do beings of the class Reptilia perform gas exchange in the same way amphibians do? These beings do not have permeable skin so they do not make cutaneous respiration such as a

Describe the functionality of implant material, Functionality of implant ma...

Functionality of implant material It should take maximum advantage of available bone and permit the maximum amount of forces to be transmitted through the implant within physio

What is intracellular digestion, What is intracellular digestion? Intra...

What is intracellular digestion? Intracellular digestion, or cellular digestion, is the breaking in the interior of the cell of big molecules coming from outside or even from i

What is inflammatory bowel disease, Q. What is Inflammatory Bowel Disease? ...

Q. What is Inflammatory Bowel Disease? Inflammatory bowel disease is a general term used to refer to chronic inflammatory condition of the intestine. It is applied to three con

Which foods are used by microorganisms for energy, Q. Which Foods are used ...

Q. Which Foods are used by Microorganisms for Energy? The carbohydrates, especially the sugars, are most commonly used as an energy source, but other carbon compounds can also

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd