Nursing diagnosis, Biology

Assignment Help:

Nursing Diagnosis

  1. Nursing diagnosis are judgements or conclusions reached by you after analyzing the data base that indicate a potential or actual human need that you as a nurse can address. 
  2. It is a description of current and potential problems of client that can be alleviated by nursing interventions.

Actual problem or potential problem and factors that produced the problem. It is a statement of a client's actual potentials and factors that produced the problems.

So you have to identify the factors which actually produce the problems in individual client/child. While making diagnosis you may come across following problems.


Related Discussions:- Nursing diagnosis

Emerging trends in nutritional content of technologically, Define Emerging ...

Define Emerging trends in the nutritional content of technologically? Increased concern about the nutritional content of technologically derived, advanced foods is expressed by

Cutaneous respiration in frog, Cutaneous respiration in frog Frog be...

Cutaneous respiration in frog Frog belongs to class Amphibia under vertebrates. It is an amphibious animal which can live both on land and in water. Skin is very impor

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Rheumatic fever, Rheumatic fever is an immunologically mediated connective ...

Rheumatic fever is an immunologically mediated connective tissue disorder following throat infection with group-A streptococci (GAS). It is characterised by an inflammatory proces

Diagnosis of diabetes mellitus, Q. Diagnosis of diabetes mellitus? Time...

Q. Diagnosis of diabetes mellitus? Timely and proper diagnosis plays a key role not only in identifying new cases but also in managing old cases with or without diabetic compli

Proteins, Proteins Proteins are continually synthesised in the cells a...

Proteins Proteins are continually synthesised in the cells as they are the principal component required for growth. Proteins are composed of amino acids which are derived larg

What are the oligosaccharides and monosaccharides, Q. What are the oligosac...

Q. What are the oligosaccharides, monosaccharides and polysaccharides? Monosaccharides are simple molecules of carbohydrates that cannot be broken down into smaller molecules o

Explain healthy nutrition, Explain Healthy nutrition There is no doubt...

Explain Healthy nutrition There is no doubt that adoption of Healthy nutrition lifestyle and the practice of good nutrition habits would help eliminate many health problems ca

Write short note on cholesterol, Cholesterol, from stereos (solid) and the...

Cholesterol, from stereos (solid) and the Greek chole- (bile) followed by the chemical suffix -ol for an alcohol is an organic chemical substance classified as a waxy steroid of fa

Kingdom protists, phyla of animal like protists that have free living membe...

phyla of animal like protists that have free living members

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd