Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The female I-1 and her mate, male I-2, had four children, one of whom has albinism. What is the probability that they could have had a total of four children with any other outcome except one child with albinism and three with normal pigmentation? the male and female are heterozygous
Some hyperthermophilic organisms that grow in highly acidic (pH2) habitats belong to the two groups: 1. Eubacteria and archaea 2. Cyanobacteria and diatoms 3. Protists and
Explain the Food Irradiation - method of food preservation? Food irradiation is another sterilizing technique in which the foods are bombarded by high-energy rays called gamma
The allele that causes albinism (p) is recessive to the allele for normal pigmentation (P). A normal woman whose father is an albino marries an albino man whose parents are both no
Q. Write the meaning of diabetes mellitus? The word "diabetes" is from the Greek word meaning "a siphon". Diabetes patients had polyuria (passing excessive urine) and "pass it
LACTATION - Production of milk in the female's breasts after delivery is lactation. Prolactin is responsible to synthesize milk in breast. Oxytocin is responsibleto gi
Define Meat as a Rich Source of Protein? Skeletal or striated muscles are used for food purposes. Flesh of cattle, sheep and swine comprise most of the meat contents. Edible me
Determine the Benedict's Test Glucose in urine is detected by Benedict's method and the test is known as Benedict's test. This test is used to detect glucose in urine (Glycosur
Human Impact on Nitrogen Cycle Human activities are profoundly affecting the cycling of nitrogen in nature. Over 30 x 10 6 metric tons/yr. of N 2 is fixed in the commercial
Question 1 Write a short note on the following- Totipotency Soma clonal variation Bioreactor Virus indexing Question 2 List and explain any 4 advantages of
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd