Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Steps for Conversion of food Conversion of food is done in four steps: 1) Ingestion, mastication and swallowing: Ingestion or taking in of food and mastication are done b
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
DNA Replication Deoxyribonucleic acid (DNA) is the carrier of genetic data for all living creatures. An organism's genome, made of DNA, encodes the genetic blueprint for buildi
Define Solubility affecting absorption of dietary iron? Solubility is crucial for non-haem iron absorption as the inorganic iron salts have to be solubilized in the intestine f
Q. What are the secondary and the primary constrictions of a chromosome? And what is the other name given to the secondary constriction? Primary constriction is the narrower re
Indications 1) Symptomatic patient with normal LV function (ejection fraction 2 0.5 at rest). If they are in class In or IV NYHA, surgery is recommended. In this group of pat
GRAFFIAN FOLLICLE - It appears as knob or stigma in medulla. It is round, discovered by Graff. It is covered by 2 layers - thecae externa & theca interna. From theca i
Explain Unresorbable Barriers - Root Perforation MTA exhabits excellent tissue biocompatible non resorbable barrier and restorative material. It represents an extraord
Explain Phylum Cnidaria - Coelenterates? Members of the Phylum Cnidaria and one other group-Phylum Ctenophora (the comb jellies)-are the only two animal phyla that have radiall
Q. Explain about Congestive Cardiac Failure? It is an end stage heart disease and a significant contributor to morbidity and mortality particularly in the elderly population. C
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd