Nocardiosis, Biology

Assignment Help:

Nocardiosis


Nocardiae are aerobic, saprophytic, gram-positive, partially acid-fast filamentous bacteria. Currently, there are 30 species included within the genus. Members of the genus Nocardia were originally classified as fungi, but these are now considered bacteria based on the presence of cell wall muramic acid, lack of membrane-bound nucleus and mitochondria, and sensitivity to antibacterials. Nocardiae were first described by Edmond Nocard, a French veterinarian who isolated the organism in 1888 from cattle with farcy. Nocardiosis is a chronic, granulomatous, suppurativeinfectious disease caused principally by N. asteroides which occurs as saprophyte in soil. Other species of Nocardia such as N. caviae and N. brasiliensis have also been incriminated in the aetiology of nocardiosis. The pathogen has a predilection for central nervous system which is manifested by brain abscess and other pyogenic lesions of meninges. The disease has been observed in human, dog, cattle, horse and monkey. The infection is acquired through the inhalation of infectious organisms from the soil. Though the primary focus of infection is in lung, infection may be disseminated to other parts of the body through haematogenous route.


Symptoms: A dog exhibits reduced appetite, sub-laryngeal swelling and fever. Very  rarely a dog may attack and bite unprovoked and show neurological signs suggestive of rabies. However, the examination of brain will exclude the possibility of nigri bodies which is pathognomonic for rabies. Madura foot may also occur in canines which is manifested by swelling of the foot, pain and oozing out pus from sinus. The pus contains whitish yellow to red or black granules. In cows and goats, this organism is a frequent case of mastitis. The affected animals show swelling of mammary gland, reduced milk yield, anorexia and mild temperature. The mammary exudate is whitish and viscous in consistency and contains small whitish granules and blood clot. The organism is also associated with corneal ulcer in cattle. The diseased bullock shows photophobia and oedematous swelling of the eye.


Diagnosis:
The organism can be easily isolated on Sabouraud’s agar without antibiotics from the infected material such as pus, milk, corneal scraping and other tissues. Gram-positive, acid-fast fimaments, along with shorter cocco-bacillary forms are demonstrated in the smear prepared from clinical specimens. Specimens should not be chilled or frozen. Specimens for diagnosis of nocardiosis should be cultivated on blood or Sabouraud dextrose agar and incubated at 25°C and 37°C for 4 to 5 days. The cultures have an odor like wet dirt. The presence of aerial hyphae differentiates the genus Nocardia from others.


Histological examination of autopsy or biopsy material may also be helpful in confirming the diagnosis of nocardiosis. Tissue sections stained with modified Brown- Brenn stain or methanamine silver nitrate are examined for the presence of thin- branched hyphae. The pathogenicity of the isolate is tested in mice, guinea-pig and rabbit. The disease may be differentiated from tuberculosis and rabies.


Diagnostic serology offers little value due to antigenic heterogeneity among nocardial pathogens. Detection of antibodies in patients can be done using indirect immunofluorescent microscopy and enzyme-linked immunosorbent assay (ELISA) or Western blot analysis for specific antigens.Treatment and prevention: Antimicrobial susceptibility should be done by a broth microdilution method rather than by use of antimicrobial-impregented disks in a conventional Kirby-Bauer test. Penicillin is not effective therapeutic agent for nocardial infection. There is no effective antimicrobial treatment for noardial mastitis. Since the species of Nocardia are sensitive to sulpha drugs and antibiotics, treatment with any of the chemotherapeutic agents may be helpful. Trimethoprim-sulfonamide, sulfamethoxazole, ampicillin or tetracycline therapy yield fruitful results. Nocardiae are fairly resistant to the fluoroquinlones. Abscesses, empyemas and serosa effusions are treated by drainage and lavage. Other drugs include doxycycline and minocycline.


Related Discussions:- Nocardiosis

Explain control function of organic molecules, What are some examples of th...

What are some examples of the control and informative function of organic molecules? Based on genetic information, organic molecules control the whole work of the cell. The nuc

What are herbicide tolerant crops in ecological, What are Herbicide toleran...

What are Herbicide tolerant crops in ecological Herbicide tolerant crops (HTC)  Ecological  a)  Increased use of the herbicides that plant is  tolerant to (describes ecologi

What is an oligopeptide, What is an oligopeptide? How is it different from ...

What is an oligopeptide? How is it different from a polypeptide? Peptide is the molecule produced by the union of amino acids through the peptide bond. Oligopeptide is a peptid

Explain about the microcolony deft, Explain about the Microcolony DEFT? ...

Explain about the Microcolony DEFT? It allows determination of viable cells. Food homogenate is filtered through a DEFT membrane and then placed on the surface of appropriate c

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Threatened species - wildlife, Threatened Species - Wildlife Many plan...

Threatened Species - Wildlife Many plant and animal species are threatened by the possibility of extinction. However, the seriousness of the threat varies. For example, a spec

Define aortic regurgitation, Q. Define Aortic regurgitation? Aortic reg...

Q. Define Aortic regurgitation? Aortic regurgitation is a common valvular disease that may present chronically or acutely. Normally the integrity of valve closure depends upon

Which types of mammal are included in the primate group, Which types of mam...

Which types of mammal are included in the Primate group?  The Primate group contains a) Lemurs, b) Monkeys, c) Apes and humans.

Explain the nonpolar molecular attractions, Explain the Nonpolar Molecula...

Explain the Nonpolar Molecular Attractions in basic chemistry? Nonpolar Molecular Attractions :  Van der Waals forces and hydrophobic interactions are weak (not as strong

Explain the heat fixation method, Explain the Heat Fixation Method? Thi...

Explain the Heat Fixation Method? This is the usual method. Here, bacteria is fixed by gentle heating of air-dried bacterial film, which results in coagulation of bacterial pro

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd