nitrogen balance, Biology

Assignment Help:
factors affecting nitrogen balance

Related Discussions:- nitrogen balance

What are the cells that produce the myelin sheath, Q. What are the cells th...

Q. What are the cells that produce the myelin sheath? Of which substance is the myelin sheath formed? In the central nervous system (CNS) the myelin sheath is made by appositio

Determine the basic seven food groups - nutritions, Determine the Basic Sev...

Determine the Basic Seven Food Groups - Nutritions? These basic seven food groups are: 1) Cereals and cereal products 2) Pulses (also meat and meat products) 3) Milk and m

Diagnosis, D i a g no s i s Diagnosis, the key for successful ma...

D i a g no s i s Diagnosis, the key for successful management of the disease problem, refers to identification of the cause of a disease. The process of diagnosis requir

What is haemoglobin, Q. What is haemoglobin? What is the inorganic element ...

Q. What is haemoglobin? What is the inorganic element that is basic of the composition of haemoglobin? Haemoglobin is the protein present in the blood responsible for the trans

What are heterochromatin and euchromatin, Chromatin is uncondensed nuclear ...

Chromatin is uncondensed nuclear DNA, the typical DNA morphology in interphase (the phase of the cell cycle in which the cells is not separating itself). In this phase of the cell

Difficulty of establishing collaborations - infuse biology, Explain the Dif...

Explain the Difficulty of establishing and sustaining collaborations? Working with another is both rewarding and challenging. Working across disciplines is even more so. Though

Photosynthesis., C4 plants have higher net photosynthetic rate because ...

C4 plants have higher net photosynthetic rate because a.they have no photorespiration b.can photosynthesise in low in

What is bioremediation, Q. What is bioremediation? The Bioremediation i...

Q. What is bioremediation? The Bioremediation is the use of microorganisms, like protists, bacteria and fungi to degrade noxious substances turning them into non toxic or less

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Effect of single base pair mutation on the cftr protein, Cystic fibrosis (C...

Cystic fibrosis (CF) is caused by a variety of mutations in the CFTR gene. Imagine you have identified a new single-base pair mutation (A→T) in an exon of the CFTR gene. You wish t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd