Neural circuits, Biology

Assignment Help:

Neural Circuits

The simple all are none activities of a single neuron can hardly provide the adaptability needed for the constant changes faced by the organism in its internal and external environments. Information about the external environment is integrated with signals arising within the organism and transmitted to effectors to elicit a coordinated response. Thus each neuron forms a unit in a communication circuit. A survey of the features of the nervous system in the animal groups at various points on the phylogenetic tree shows that a long evolutionary process has produced the outstanding complex structure of the human brain.

83_Neural Circuits.png

Figure: Nerve Net in Jelly Fish

Protozoans are single celled organisms and clearly cannot have a nervous system. An examination of the electrical properties of the protozoan cell membrane would, however, show many similarities to those of nerve cells including electrical potential changes and currents associated with activity. Coelenterates are of great interest neurologically since they are the first animals to possess a true nervous system. The coelenterate nervous system consists of a diffuse network of neurons that are distributed throughout the body wall. Such a simple and primitive nervous system is termed a nerve net in which neurons are dispersed mostly at random. Though primitive, this arrangement serves the need of a radially symmetrical animal whose food and enemies may approach from all directions. The animal's reaction depends on the strength of the stimulus. Only a part of the body reacts to a weak stimulus and a strong stimulus causes the entire animal to respond. From such diffuse primitively organised system of nerve cells, evolution has produced a complex organized nervous system such as that of man. The system of local nerve nets, however continues to exist even in many advanced invertebrate groups and in the intestines of vertebrates.


Related Discussions:- Neural circuits

What is the echocardiogram, What is the Echocardiogram ? When doubts pe...

What is the Echocardiogram ? When doubts persist whether a patient has CHD or not despite a thorough clinical exam and chest X-ray, ECG, and hyperoxia test, an echocardiogram s

Types of plastids, TYPES OF PLASTIDS (1 ) LEUCOPLASTS These are p...

TYPES OF PLASTIDS (1 ) LEUCOPLASTS These are present in ground parts of plants, internal parts of herbaceous stems and deep tissues of plants where sun light is not avail

Zoonoses disease-pseudorabies, Pseudorabies Pseudorabies is a viral di...

Pseudorabies Pseudorabies is a viral disease caused by pseudorabies virus (PRV) that is classified under family Herpesviridae. This disease is also known as “Aujeszky’s diseas

What do you mean by pneumatic bones, Q What are pneumatic bones? Birds ...

Q What are pneumatic bones? Birds have lightweighted bones with internal spaces filled with air. These bones are called pneumatic bones this feature reduces the corporal densit

Explain horizontal full mucoperiosteal flaps, Explain Horizontal Full Mucop...

Explain Horizontal Full Mucoperiosteal Flaps - Endodontic Surgery      a) Also called:  Envelope flap, b) Only a Horizontal incision, without the vertical releasing incision

What phenotypic ratios of the diploid, A wild-type strain of haploid yeast ...

A wild-type strain of haploid yeast is crossed to a mutant haploid strain to make a diploid. What phenotypic ratios will be observed in the haploid progeny of the diploid?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Respiratory protection - azotobacter, Respiratory Protection - Azotobacter ...

Respiratory Protection - Azotobacter In respiratory protection N 2 -fixing cells adjust the rate of .aerobic respiration according to prevailing oxygen tension i.e. rising and

Define obligatory and facultative water excretion, Define Obligatory and Fa...

Define Obligatory and Facultative water excretion? i) Obligatory water excretion: The kidney is 'obligated' to excrete some water to rid the body of its daily load of urinary s

Essentiality of phosphorus for growth of microorganism, Define Essentiality...

Define Essentiality of Phosphorus for Growth of Micro-Organism Phosphorus is used in the form of phosphate salt by microorganisms. It is involved in formation of nucleic acids,

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd