Nervous system - spinal cord, Biology

Assignment Help:

SPINAL CORD (MYELON)

It is part of CNS. 45 cm long (in woman 43 cm) & weight 35 gms.

Origin from lower part of medulla oblongeta.

  • Shape -

Long cylindrical, convex dorsally and flat ventrally.

Last end part is conical i.e. conus terminalsis which in the end becomes thread like i.e. filum terminalis.

It is having branchial and lumbo sacral swelling at the point of origin of fore leg and hind leg.

  • Position - Present on dorsal side inside neural canal of vertebral column upto first lumber vertebrae.
  • Meninges - Similar to brain, epidural space also present filled with fat & connection tissue.
  • Matter - White matter is outer & grey matter is inner.
  • C.S.F.- Circulatin of CSF is posterior to anterior.
  • STRUCTURE -

Spinal cord is hollow, its lumen is central canal or neurocoel filled with C.S.F.

Canal is lined by ependyma of ependymal cells. Grey mater is butterfly or H-shaped.

In it 3 pairs cornue present, these are dorsal, ventral & lateral horns.

In white matter area closed to horn is dorsal, ventral & lateral funiculli.

Dorsal horn forms dorsal arch. Ventral horn forms ventral arch.

On dorsal side dorsal sulcus with septum is present. On ventral side ventral fissure is present.

  • FUNCTIONS -

It conducts impulses to and from the brain. It controls reflex action.


Related Discussions:- Nervous system - spinal cord

Define preterm and low birth weight, Define Preterm and Low Birth Weight? ...

Define Preterm and Low Birth Weight? The foetal and neonatal health is mainly dependent on the birth weight and it has been well recognized that perinatal (from birth upto one

Define miscellaneous functions of protein, Define Miscellaneous Functions o...

Define Miscellaneous Functions of Protein? Besides the functions enumerated above certain other important miscellaneous functions of proteins are included herewith. These inclu

The prs kit for post removal uses-endodontics principles, The PRS kit is co...

The PRS kit is comprised of          -5 variously sized trephines and corresponding tubes according to material if it's silver or silver point          -A transmetal bur

Urine sugar testing, Testing for urine sugars is not recommended for either...

Testing for urine sugars is not recommended for either diagnosis or monitoring of patients with diabetes. This is because a urine sugar is not a reliable test. When no facilities a

Determine the human genome project, List three important discoveries that r...

List three important discoveries that resulted from the Human Genome Project. Answers should contain three of the following: Only about 2 percent of the human genome encodes p

Where does calvin cycle take place in chloroplast, Where does Calvin cycle ...

Where does Calvin cycle take place in chloroplast? Explain the cycle. a) Where is electron transport system operative in mitochondria? b) Explain the system highlighting the

Explain the phase contrast microscope, Explain the Phase Contrast Microscop...

Explain the Phase Contrast Microscop? Unpigmented and unstained living cells can be easily observed by phase contrast microscope. It has a special objective and a condenser th

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Adverse effects of air pollution, Air pollution affects both living and non...

Air pollution affects both living and non-living matter. The effects can be classified as.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd