Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.
ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG
M S L P Q S R W V A C F S I E G I L Y P
This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.
Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.
Explain the term active transport? Active Transport : At intervals, protein assemblies involved in selective, or active transport of materials are inserted into the cell mem
Define the Operations of a Public Nutritionist? A public nutritionist can perform the following: In the hospital-based set up, she is a part of the team delivering thera
Q. Whcih group of individual animals and plants called Species? A group of individual plants and animals that are fundamentally alike is treated as a ,species. Species is a par
Explain the Peripheral Resistance Resistance offered by arterioles or resistance vessels, as you have read above, is termed as peripheral resistance. Changes in peripheral resi
Explain the Fluoride Toxicity? Fluoride is a cumulative toxin. Ingestion of fluoride 1.0-1.5 mg/L for several years may produce dental fluorosis, i.e. browning and pitting of t
How to grow root hairs Hairs can simply be seen on the roots of mustard seed grown on a damp flannel. Seeds placed on an earthenware dish standing in a soup plate having water
Sickling occurs in deoxyhemoglobin S, but not in oxyhemoglobin S. Oxyhemoglobin has a small hydrophobic \"pocket\" in a ß chain region located in the interior of the protein. In de
Determine the term - Epilepsy In epilepsy, a person suffers from recurrent seizures of various types that register on an electroencephalogram and are associated with disturbanc
diseases of the large intestine
Define the Stress Response - nutrition during stress? The terms trauma, stress, shock are very often used interchangeably and encompass a variety of conditions such as sepsis
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd