N-terminal cysteine amino acid , Biology

Assignment Help:

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 


Related Discussions:- N-terminal cysteine amino acid

What is osseointegration, What is Osseointegration Osseointegration was...

What is Osseointegration Osseointegration was the hallmark of success in implant dentistry in the 1980s. It was believed that an implant was successfully integrated when there

Determine the interphase of mitosis, Is the interphase of meiosis differen...

Is the interphase of meiosis different from the interphase of mitosis? The interphase that precedes meiosis is same to the interphase that precedes mitosis. In them the major e

Determine the food sources of iodine, Determine the Food Sources of Iodine?...

Determine the Food Sources of Iodine? Please note that unlike other minerals studied so far, like selenium, the iodine concentration in foods is highly variable and also depend

Explain a renewable exhaustible natural resource, A renewable exhaustible n...

A renewable exhaustible natural resource is: 1. Coal 2. Petroleum 3. Minerals 4. Forest Forest is a renewable exhaustible natural resource

Define about skeletal system, Define about Skeletal system Skeletal sy...

Define about Skeletal system Skeletal system provides framework to the body; supports the soft tissues; protects delicate organs. The skeletal system is made up of bones an

Why degree of dispersion of protein solution is decreased, Degree of disper...

Degree of dispersion of protein solution is decreased. It is decreased because of certain reasons:- Association: refers to changes occuring at subunit or molecular leve

Define biochemistry, Biochemistry : The chemistry  of  living organisms ...

Biochemistry : The chemistry  of  living organisms that covers all  the chemical reactions occurring  in our body.

Blood and its composition, BLOOD - Blood is a mobile connective tiss...

BLOOD - Blood is a mobile connective tissue composed of a fluid, the plasma and the cells, the blood corpuscles. Blood is basis of life. Blood is the softest tissues

Signs and symptoms of hypothyroidism, Q. What are some signs and symptoms f...

Q. What are some signs and symptoms found in patients with hypothyroidism? In hypothyroidism the production and secretion of T3 and T4 are impaired. Since these thyroid hormone

Explain the term - seashore rhythm test, Explain the term - Seashore Rhythm...

Explain the term - Seashore Rhythm Test This test consists of 30 pairs of rhythmic patterns. The task is to judge whether the two members of each pair are the same or different

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd