Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.
ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG
M S L P Q S R W V A C F S I E G I L Y P
This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.
Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.
Population You must be familiar with the term 'population'. It is one of the most talked about issues of this century. It is feared that the rapid growth of the world population
PROTEINS Protein was discovered by Mulder. Berzilius gave the catalytic concept & gave the word protein, which means first rank. Protein holds the 1st place in
Give definitions of atomic number and atomic mass and how they relate to protons, neutrons, and electrons in neutral atoms?
what arachnid is beneficial
In which period of meiosis does the pairing of homologous chromosomes occur? The pairing of homologous chromosomes is an essential step for meiosis because the rightness of the
Explain about the Osteomalacia - Deficiency of Vitamin D? It occurs when there is a lack of vitamin D and calcium, in women who have had many pregnancies, who subsist on a meag
Define Male and Female Ascaris Lumbricoides? Ascaris lumbricoides unlike most free-living nematodes and a large number of parasites of plants and animals are not tiny or micro
What is the Classification of Burns? Burns can be classified on the basis of the extent, depth, patient age and associated illness or injury. On the basis of depth, burns are u
Q. Describe the process of Rodent control? Rats and mice are destructive and cause huge loss of stored food commodities. They transmit pathogenic bacteria. Rats and mice are ge
Q. Define Central nervous system? The nervous system begins as a simple tube during embryonic development (then anterior part expands and also ventricles are formed). Foreb
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd