Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.
ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG
M S L P Q S R W V A C F S I E G I L Y P
This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.
Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.
Consider Neuron B in the frog central nervous system whose plasma membrane has a previously unknown channel that is selectively conductive to a newly discovered tetravalent anion n
Long-Day Plants (LDP) - Plant Responses to Light-Dark Cycles The definition of this is exactly opposite to short-day plant. That is those plants which flower when given more t
Q. What is the major transformation presented by the glomerular filtrate in comparison to the blood? Glomerular filtrate is the name given to the plasma after it has entered th
Explain Periimplant Marginal Tissues of Mucosal Conditions In addition to the redness and swelling of the marginal tissues, bleeding on probing (BOP), pocket formation, and sup
Osmotic Strength of the Fluids in Immediate Surrounding The availability of soluble mineral salts varies widely from habitat to habitat. In fact, a big chunk of land in our
Define Dietary Factors with Antinutritional Effects? In the above sections, we have learnt about a variety of food components having a host of health promotive properties. Let
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Ascariasis This disease is found in young calves causing digestive disturbances and poor growth. E t iology: It is caused by Toxocara vitulorum in cow and buffal
Q. What are the catalysts? Catalysts are substances that decrease the activation energy of a chemical reaction, facilitating it or making it energetically viable. The catalyst
Define Soyabean and sesame proteins - mutual supplementation of Protein? Soyabean and sesame proteins: Soyabean proteins are good sources of lysine but are deficient in methion
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd