Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.
ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG
M S L P Q S R W V A C F S I E G I L Y P
This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.
Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.
Q. What is selective waste collection? The Recyclable waste is waste that can be reprocessed and used again. The waste recycling depends on the separation of the recyclable res
Germ layer theory
Glycolysis generates two ATPs net per glucose whereas gluconeogenesis uses four ATPs and two GTPs per glucose. Thus, if both glycolysis and gluconeogenesis were allows to opera
Photosynthetically Active Radiation This is usually in direct proportion with the incident solar radiation, you know that tropic$ are probably the best illuminated part of the
How many grams of sodium dodecyl sulfate (mw = 288.37) would you dissolve in 80 mLs of water to make a 20% solution of SDS?
Explain Cyanotic Heart Disease breifly? Presence of cyanosis means deoxygenated blood reaching the systemic circulation bypassing the lungs i.e., right to left shunt. Uniform c
Name of the structures you would expect to find in the dermis. In the dermis you would expect to search sensory nerve endings, nerve fibres, capillaries, arterioles and venules
What are cytokinins? Where are they made? Cytokinins are phytohormones active in the promotion of cellular division; they slow down the aging of tissues and act together with a
Define Dietary Goals in Parkinson's Disease? The main goals include: - Maintain desirable weight - Promote absorption of anti- Parkinson's drug levodopa - Lessen swall
Which of the below statements does NOT apply to arteries when comparing them to veins: a) Have thick walls b) Carry blood away from heart c) Highly elastic walls d) Ha
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd