Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.
ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG
M S L P Q S R W V A C F S I E G I L Y P
This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.
Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.
Prevention of flap necrosis Flap necrosis can be prevented if the surgeon attends to four basic principles. 1. First, the apex of a flap should never be wider than the base,
Structure of HIV HIV is a spherical enveloped virus of about 90-120 nm diameter .In nucleocapsid is icosahedral. Its genome consists of a single stranded RNA filament segmented
Q. What are the roles of ATP and NADPH in the chemical stage of photosynthesis? NADPH acts as reductant of carbon dioxide it delivers highly energetic hydrogen to precursor mol
Peste des petits ruminants (PPR) is an acute, highly contagious viral disease of goats and sheep caused by peste des petits ruminants (PPR) virus which belongs to the genus Morbil
Explain about the Adequate Intake (AI)? If sufficient data are not available to establish an EAR and hence RDA, the AI is derived instead. The AI is derived from observations o
Define Carcinogenic - Non-dietary Factors? A large number of agents cause genetic damage and induce neoplastic transformation of cells, they fall into the following categories.
Q. Etiologic factor of dyslipidemia? The causative factors of dyslipidemia/hyperlipidemia may be environmental (dietary/ lifestyle), genetic or secondary to certain disease con
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Diagnosis Clinical signs: In most of the cases in initial stages like bacterial infections there is leucocytosis with neutrophilia, which at later stages of the disease may c
Explain the Resorbable Barriers - Root Perforation It is successfully control internal bleeding through cronal access It is intended to forced in the bone, not left wi
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd