Myocardial ischemia, Biology

Assignment Help:

In patients with coronary artery disease an acute coronary syndrome event can precipitate heart failure. Mitral regurgitation occurring as a result of papillary muscle ischemia contributes to heart failure and may even produce acute pulmonary edema.


Related Discussions:- Myocardial ischemia

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Cleavage, what are the chemical changes during cleavage

what are the chemical changes during cleavage

Describe in brief about failing implant, Describe in brief about failing im...

Describe in brief about failing implant The failing implant may show evidence of pocketing, bleeding upon probing, purulence, and indicates the bone loss patterns are progressi

Class polychaeta - classification of coelom, Class Polychaeta - Classificat...

Class Polychaeta - Classification of Coelom There are mainly marine forms with distinct head, having eyes and tentacles, segments have lateral projections of the body wall ter

What is total amount of both reactants and products decrease, In Chemical R...

In Chemical Reactions that have a large negative /\Go' a- the total amount of both reactants and products decreases b- the products are less stable than the reactants c- t

Skeleton, what is the biological significance of skeleton

what is the biological significance of skeleton

Heteroduplex dna, Heteroduplex Dna  is generated by the base pairing betwee...

Heteroduplex Dna  is generated by the base pairing between complementary single strands derived from the different parental duplex molecules; heteroduplex DNA molecules occuring du

How do copper and hormone releasing iuds, a) How do copper and hormone rele...

a) How do copper and hormone releasing IUDs act as contraceptives? Describe. b) If you squeeze a seed of orange you may be observe many embryos of different sizes.  How is it

Irritability, Irritability If a bright torch of light is flashed acros...

Irritability If a bright torch of light is flashed across your eyes, you close your eyes instinctively. The bright light acts as a stimulus (pl, stimuli) and closing your eyes

How did the first fermenting autotrophs appeared, How did the first ferment...

How did the first fermenting autotrophs appeared? What about the first aerobic beings? A heterotrophic hypothesis asserts that the first living beings were the fermenting heter

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd