Mycotoxins, Biology

Assignment Help:

Fungi are a very diverse group of organisms and have a significant impact on the production, spoilage and safety of food. Molds have not only served to synthesize antibiotics but also to produce some foods. Fermented foods such as some cheese, soy sauce, miso, tempeh and other oriental delicacies are prepared with the help of molds.

It is well documented that some molds produce toxic substances. Amanita, a poisonous mushroom elaborates the toxin in macroscopic fruiting bodies. Some fungi always grow and sporulate as parasites on living host plants, and sometimes will do so only on a specific host. Claviceps is an example of this group of fungi and it produces mycotoxins. In contrast to fungi that are parasitic on living plants another group of fungi is saprophytic and causes destruction of dead plants and animal material. There is abundance of the spores of these molds in atmosphere and are found to inhabit stored grain and dried products and hence have been referred to as "storage fungi". These molds include Cladosporium, Fusarium, Penicillium, Aspergillus and Alternaria.


Related Discussions:- Mycotoxins

Soil texture and structure, SOIL TEXTURE AND STRUCTURE We have seen that ...

SOIL TEXTURE AND STRUCTURE We have seen that soils are predominantly composed of particles of various sizes derived from the disintegration or decomposition of parent rock materi

Explain about myocardial infarction, Q. Explain about Myocardial Infarction...

Q. Explain about Myocardial Infarction? It is an initial acute phase of cardiovascular disease caused by the blockage of a coronary artery supplying blood to the. Heart shows t

What is plutonium reprocessing, Q. What is plutonium reprocessing? Why is i...

Q. What is plutonium reprocessing? Why is it a big environmental issue? The Plutonium is the highly radioactive chemical element produced from uranium by nuclear plants. The Pl

Explain the selective media - culture media, Explain the Selective Media - ...

Explain the Selective Media - Culture Media? It is used to select specific groups of bacteria by favouring the growth of desired bacteria and inhibiting the growth of undesired

Amphibians - regeneration in vertebrates, Amphibians - Regeneration in Vert...

Amphibians - Regeneration in Vertebrates Newts and salamander show remarkable regenerative ability in larval as well as adult stages. In larval stages except for limbs and tai

Explain about the term- therapeutic, Explain about the term- Therapeutic ...

Explain about the term- Therapeutic Therapeutic approaches that scientists are pursuing include transplanting cells to replace those which are damaged or using growth factors

What is the importance of iron in diet, Q. What is the importance of iron i...

Q. What is the importance of iron in diet? What is the disease caused by iron deficiency? Iron acts as a constituent of the hemoglobin molecule and of enzymes of the energetic

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define cause of vitamin a deficiency - poverty and ignorance, Define cause ...

Define cause of vitamin a deficiency - Poverty and ignorance? Low purchasing power of the communities and their consequent inability to meet the nutrient requirements and tradi

Blood clotting, BLOO D CLOTTING - It is a nature's device to check ...

BLOO D CLOTTING - It is a nature's device to check the excessive loss of blood from an injury. Bleeding time is 1-3 minutes. Clotting time is 2-6 minutes. Process of

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd