Mycoplasmosis, Biology

Assignment Help:

Contagious bovine pleuropneumonia (CBPP)

This is a highly fatal disease of cattle and of major economic importance in certain tropical countries. It also affects buffaloes, bison and reindeer.

Epidemiology: The disease is widespread in tropical regions. It causes serious economic losses in Africa, Asia and Australia. It still exists in China and is prevalent in tropical Africa. In India, the disease existed in districts of upper parts of Asom, but  now it has been completely eradicated from our country (May 2007, OIE). Under natural conditions, the disease spreads through infected droplets excreted from the respiratory tract of affected animals. The recovered animals continue to harbor the organism and remain as a source of infection up to 18 months. The incubation period varies from 1 to 4 months. Cattle of all ages suffer from the disease.


Etiology: The causative organism is Mycoplasma mycoides subsp. mycoides type SC (Mmm SC). The organism is pleomorphic and may pass through standard bacterial filters.  The disease is generally confined to lungs and pleura.


Clinical symptoms: High temperature (about 1040F) along with dry cough is the main symptom. Later, the cough becomes more severe and animals show signs of pain. The temperature declines before death due to asphyxia. The course of disease is 2-6 weeks. Pregnant animals abort during acute phase of illness. Sometimes edema occurs at the throat. A discharge of thick mucus appears at nose and mouth. In acute cases, death occurs within 1 – 3 weeks after the first clinical signs appear. In chronic cases, the disease may persist for 7 weeks. Sometimes only mild symptoms appear and these animals survive, but infection persists and animals continue to excrete the organism.


Postmortem lesions: The main lesions are found in lung, but characteristic lesion found on postmortem is varying degrees of hepatization of lobules separated from each other by thickened interlobular septa. The thorax contains several liters of blood- strained pleuritic fluid. The pleura shows edematous thickening with a layer of fibrin. Sometimes, a section of lung is necrosed and surrounded by fibrous tissue. In living animal, this encapsulated area (sequester) may burst under certain conditions and redistribute the organisms.


Diagnosis: Diagnosis is based on history of the case, symptoms and characteristic lesions. The confirmatory diagnosis is carried out by testing the serum samples of the suspected animals by using complement fixation test. The molecular techniques, viz. PCR, RE analysis and DNA probes are also helpful in diagnosis of the disease.


Control:
Prevention and control of contagious bovine pleuropneumonia depends upon the diagnosis of infection, slaughter of diseased animals, prohibiting the movement of animals and protecting individual animal by vaccination. A live attenuated vaccine (T1- 44) is recommended by the OIE for vaccination of the cattle. Since the disease has been eradicated from India, there is no need of vaccination in animals


Related Discussions:- Mycoplasmosis

Calculate concentration of solution from standard curve, Calculate the Conc...

Calculate the Concentration of Unknown Solution from Standard Curve? i) First take different volume of standard solution (say 0.2, 0.4, 0.6, 0.8, 1.0 ml) and then calculate the

Nutrient elements of plants, Nutrient Elements of Plants Let us first ...

Nutrient Elements of Plants Let us first find out the chemical composition of plants and see which element nature has selected to support their healthy growth. Only then we wi

What do you mean by dicoumarol, Q. What is dicoumarol? How does this substa...

Q. What is dicoumarol? How does this substance act in the clotting process and what are some examples of its toxicity? Coumarinic anticoagulants cannot be administered during p

Diagnosis of diabetes mellitus, Complete history taking is an initial step ...

Complete history taking is an initial step in diagnosis. You will ask the patient about present complaints, past history, family history, any drug allergy and also the kind of diet

Chlamydiosis-pathogenesis, Pathogenesis The mode of intracellular repl...

Pathogenesis The mode of intracellular replication of chlamydial agents is investigated morphologically and cytochemically with both light and electron microscope. It is estab

Explain type 2 diabetes mellitus, Q. Explain Type 2 Diabetes Mellitus? ...

Q. Explain Type 2 Diabetes Mellitus? It is the most common form of diabetes accounting for 90-95% of patients with diabetes. Type 2 Diabetes Mellitus was previously called as N

History of plant classification, Q. History of plant classification? Be...

Q. History of plant classification? Before Darwin's theory of evolution and publication of his epoch making work 'Origin of Species' in 1959 no outstanding basis for the classi

Typical signs of hip fracture-shortening, In the case story, Reggie present...

In the case story, Reggie presented with three typical signs of hip fracture-shortening, adduction, and the lateral rotation of the affected limb. What causes these signs? (HINT-th

Why is the aids treatment often done with a drug cocktail, Q. Why is the AI...

Q. Why is the AIDS treatment often done with a drug cocktail? The treatment of obtain immune deficiency syndrome is often done with one or more anti-retroviral drugs of differe

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd