muscles, Biology

Assignment Help:
what process
provides the energy for muscle contraction?

Related Discussions:- muscles

Spinal nerves, Spinal nerves: They take their origin from the spinal...

Spinal nerves: They take their origin from the spinal cord. They are the mixed nerves having both sensory and motor fibres. There are 31 pairs of spinal nerves. The se

Why cerebellum more developed in mammals that fly or jump, Q. Why is the ce...

Q. Why is the cerebellum more developed in mammals that fly or jump? The cerebellum is the main brain structure that coordinates the movement and the equilibrium of the body. F

Nutritional deficiency, Iron deficiency should be treated with supplemental...

Iron deficiency should be treated with supplemental iron. • Osteoporosis should be treated with calcium and vitamin D supplements. • Depending on individual factors, patien

How does self infection by tapeworms occur, Q. How does self infection by t...

Q. How does self infection by tapeworms occur? The Taeniasis patients may develop the most severe form of the worm infection, cysticercosis, because their feces contain eggs

Intermediate filaments - role of cytoskeleton structures, Intermediate fila...

Intermediate filaments - Role of Cytoskeleton Structures These filaments are intermediate in size among microtubules and microfilaments and are 10 nm in diameter. Five classes

Major conventional symbols & signs used in genetic family, What are the maj...

What are the major conventional symbols and signs used in genetic family trees? In the genetic family trees the male sex is usually represented by a square and the female by a

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How can the formation of sperm cells from germ cells, Indicating the name a...

Indicating the name and respective ploidy of each involved cell how can the formation of sperm cells from germ cells be described? The formation of sperm cells, or spermatogene

Explain spoilage by yeasts, Q. Explain Spoilage by yeasts? Yeasts domin...

Q. Explain Spoilage by yeasts? Yeasts dominate in the spoilage of fruit products which contain high acid content due to their ability to tolerate high acid environment. Yeast

Parasitic protozoan, Parasitic Protozoan Out of the thousands of speci...

Parasitic Protozoan Out of the thousands of species of Protozoa, the majority are free living. However, many species from within the phyla Sarcomastigophora and Ciliophora are

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd