Muscle and movements, Biology

Assignment Help:

Muscle and Movements

Earlier you have read about amoeboid movement, ciliary and flagellar movement. In this section you will learn how muscles are involved in the movement. Muscle cells are found in almost all the phyla of the animal kingdom except the phylum protozoa. Contraction and relaxation of these muscles brings about movement in the organisms. In vertebrates there are three types of muscles: skeletal muscles, cardiac muscles and smooth muscles. Skeletal muscles are attached to the bones in the arms, legs and the spinal cord and produce activities such as walking, movement of head, hands etc. Cardiac muscles are the muscles of the heart. These are specialised for continuous contractions of the heart, needed in pumping of the blood.

Smooth muscles are present in the walls of internal organs such as the large and small intestine, the gall bladder and large blood vessels. Contraction and relaxation of smooth muscles control the diameter of blood vessels and also propel food along the gastro-intestinal tract. Under the microscope the skeletal muscles and the cardiac muscles exhibit transverse light and dark bands alternating with each other. Therefore, the skeletal muscles and the cardiac muscles are also called striated muscles. The smooth muscles do not have striations.

 


Related Discussions:- Muscle and movements

What organisms make glycogen, What organisms make starch? What is it used f...

What organisms make starch? What is it used for? What organisms make glycogen? What is it used for?

Wind energy and its advantages and disadvantages, Wind energy         ...

Wind energy            Wind power is one of most cheapest renewable energy sources today. Wind turbines convert the power of wind into electrical energy. Wind occurs due to t

What is the explanation for the bleeding, What is the explanation for the b...

What is the explanation for the bleeding that accompanies menses? The hemorrhage that accompanies menses happens because the endometrium is a richly vascularized tissue. The r

Feeding on small particles, Feeding on Small Particles Microscopic alg...

Feeding on Small Particles Microscopic algae and bacteria can be taken in directly into the cell by the digestive vacuoles. But one of the most successful methods of feeding o

HUMAN SKELETON, What are the main components of the human skeleton?

What are the main components of the human skeleton?

Excretion in earthworm, EXCRETIO N IN EARTHWORM - Main organs are neph...

EXCRETIO N IN EARTHWORM - Main organs are nephredia, pharyngeal, integumentary & septed nephredia. Main are septal nephredia situated on septa.Nephrostome present. Body

Find out the electric potential, Find the electric potential, taking zero a...

Find the electric potential, taking zero at infinity, at the upper right corner (the corner without a charge) of the rectangle in the figure. (Let y = 3.7 cm and x = 6.7 cm.)

Evaluate the texture of various foods, Q. Evaluate the texture of various f...

Q. Evaluate the texture of various foods? A number of instruments are available to evaluate the texture of various foods. Brief discussions on these instruments follow. Cons

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd