Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Muscle and Movements
Earlier you have read about amoeboid movement, ciliary and flagellar movement. In this section you will learn how muscles are involved in the movement. Muscle cells are found in almost all the phyla of the animal kingdom except the phylum protozoa. Contraction and relaxation of these muscles brings about movement in the organisms. In vertebrates there are three types of muscles: skeletal muscles, cardiac muscles and smooth muscles. Skeletal muscles are attached to the bones in the arms, legs and the spinal cord and produce activities such as walking, movement of head, hands etc. Cardiac muscles are the muscles of the heart. These are specialised for continuous contractions of the heart, needed in pumping of the blood.
Smooth muscles are present in the walls of internal organs such as the large and small intestine, the gall bladder and large blood vessels. Contraction and relaxation of smooth muscles control the diameter of blood vessels and also propel food along the gastro-intestinal tract. Under the microscope the skeletal muscles and the cardiac muscles exhibit transverse light and dark bands alternating with each other. Therefore, the skeletal muscles and the cardiac muscles are also called striated muscles. The smooth muscles do not have striations.
What organisms make starch? What is it used for? What organisms make glycogen? What is it used for?
Wind energy Wind power is one of most cheapest renewable energy sources today. Wind turbines convert the power of wind into electrical energy. Wind occurs due to t
What is the explanation for the bleeding that accompanies menses? The hemorrhage that accompanies menses happens because the endometrium is a richly vascularized tissue. The r
how to make assingment for this topic
Feeding on Small Particles Microscopic algae and bacteria can be taken in directly into the cell by the digestive vacuoles. But one of the most successful methods of feeding o
What are the main components of the human skeleton?
EXCRETIO N IN EARTHWORM - Main organs are nephredia, pharyngeal, integumentary & septed nephredia. Main are septal nephredia situated on septa.Nephrostome present. Body
Find the electric potential, taking zero at infinity, at the upper right corner (the corner without a charge) of the rectangle in the figure. (Let y = 3.7 cm and x = 6.7 cm.)
Q. Evaluate the texture of various foods? A number of instruments are available to evaluate the texture of various foods. Brief discussions on these instruments follow. Cons
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd