Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
In the eukaryotes replication of chromosomal DNA happens only in the S phase of the cell cycle. As for bacterial DNA, eukaryotic DNA is replicated
figure: The eukaryotic cell cycle. The S point is typically 6-8 h long, G2 is a point in which the cell prepares for mitosis and lasts for 2-6 h, mitosis itself (M) is short and takes only about 1 h. The length of G1 is very variable and depends on the cell type. Cells can enter G0, aquiescent phase, instead of continuing with the cell cycle.
Define the Binge Eating Disorder? Binge eating disorder is probably the most common eating disorder. Binge eating you may recall we studied as an element of bulimia nervosa. In
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Enzyme glutamate oxaloacetate transaminase catalyzes the reaction between glutamate and oxaloacetate with the formation of a-ketoglutarate and aspartate due to transfer of one
Q. Is there any situation in which the DNA is made based on the RNA template? What is the enzyme involved? The process in which the DNA is synthesized having as template a RNA
It is defined as the total amount of heat produced, when unit mass/volume of the fuel has been burnt completely and the products have been cooled to room temperature (~ 15 0 C).
Full Description about microfilament
How many regulatory enzyme types known in metabolic pathways, explain in detail by giving examples.
Describe five different types of gateway vectors that are available, what different functions they can perform, and for what purpose. e.g. (1) Vector pXXX, (2) function - expre
Enumerate the working of MRI scanner The MRI scanner can be 'tuned' to detect the very subtle disturbances to the magnetic field induced by the different proportions of oxygen
what are lipids? how ther absorption takes place in human bodies?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd