Multiple replicons , Biology

Assignment Help:

In the eukaryotes replication of chromosomal DNA happens only in the S phase of the cell cycle. As for bacterial DNA, eukaryotic DNA is replicated

 

509_22.png

 

figure: The eukaryotic cell cycle. The S point is typically 6-8 h long, G2  is a point in which the cell prepares for mitosis and lasts for 2-6 h, mitosis itself (M) is short and takes only about 1 h. The length of G1   is very variable and depends on the cell type. Cells can enter G0, aquiescent phase, instead of continuing with the cell cycle.

 

 


Related Discussions:- Multiple replicons

Define the binge eating disorder, Define the Binge Eating Disorder? Bin...

Define the Binge Eating Disorder? Binge eating disorder is probably the most common eating disorder. Binge eating you may recall we studied as an element of bulimia nervosa. In

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain enzyme glutamate oxaloacetate, Enzyme  glutamate oxaloacetate tran...

Enzyme  glutamate oxaloacetate transaminase catalyzes  the  reaction between glutamate and oxaloacetate with the formation of a-ketoglutarate and aspartate due to transfer  of one

Which the dna is made based on the rna template, Q. Is there any situation ...

Q. Is there any situation in which the DNA is made based on the RNA template? What is the enzyme involved? The process in which the DNA is synthesized having as template a RNA

Higher calorific value (hcv) or gross calorific value (gcv), It is defined ...

It is defined as the total amount of heat produced, when unit mass/volume of the fuel has been burnt completely and the products have been cooled to room temperature (~ 15 0 C).

Microfilament, Full Description about microfilament

Full Description about microfilament

Explain types known in metabolic pathways, How many regulatory enzyme types...

How many regulatory enzyme types known in metabolic pathways, explain in detail by giving examples.

Describe five different types of gateway vectors, Describe five different t...

Describe five different types of gateway vectors that are available, what different functions they can perform, and for what purpose. e.g.  (1) Vector pXXX, (2) function - expre

Enumerate the working of mri scanner, Enumerate the working of MRI scanner ...

Enumerate the working of MRI scanner The MRI scanner can be 'tuned' to detect the very subtle disturbances to the magnetic field induced by the different proportions of oxygen

Absorption of lipids, what are lipids? how ther absorption takes place in h...

what are lipids? how ther absorption takes place in human bodies?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd