Moss stage - xerarch, Biology

Assignment Help:

Moss Stage - Xerarch

The accumulation of soil, particularly in the crevices and depressions of rock favours the growth of certain xerophytic mosses, e.g., species of Polytrichum, Tortula and Grimmia. The spores of these mosses are brought by the blowing wind. They have more or less the same power of withstanding desiccation as that of foliose lichens.

The lichens and mosses grow together and compete 'with one another. The rhizoids of mosses and foliose lichens compete for water and nutrients, and the stems of the former attain greater height than the latter. The plants in the lower strata, i.e., the lichens die, and the mosses grow. The mosses form cushion-like structure that may be a few centimetres in thickness. The substratum is thus gradually built up and is widened. The foliose lichens gradually give way to mosses that overtop the lichens. Many times, all three stages may be found on a single rock surface, the pioneers occupying the most exposed places.


Related Discussions:- Moss stage - xerarch

Determine the concept of neuropsychological test, Determine the concept of ...

Determine the concept of neuropsychological test A neuropsychological test therefore is defined as behavioural procedure that is particularly sensitive to the condition of the

Determine the atp-sensitive potassium channel, ATP-sensitive potassium chan...

ATP-sensitive potassium channel A. The channel is a spanning protein with a receptor site for ATP located on an intracellular region of the protein. B. When blood plasma lev

Osmosis, If you have water, 10% sucrose, and 40% sucrose solution. Which so...

If you have water, 10% sucrose, and 40% sucrose solution. Which solutions were isotonic to each other?

Nutritional demands of sports and dietary recommendations, Define Nutrition...

Define Nutritional Demands of Sports and Dietary Recommendations? There is a strong relationship between nutritional status and physical training. Whether it is to maintain hea

Explain disease motion sickness, Motion Sickness  The pathogenesis of m...

Motion Sickness  The pathogenesis of motion sickness is poorly under- stood. The prescription cholinergic blocker scopolamine in a patch or oral formulation can decrease sympto

Mutual interrelationship among individuals of a community, Mutual interrela...

Mutual interrelationship among individuals of a community Mutual interrelationship includes all the direct and indirect effects that organisms have upon each other. The three r

Heat production and respiratory quotient for foodstuff types, Heat producti...

Heat production and respiratory quotient for foodstuff types The heat produced during the metabolic activities of the body helps in maintaining the body temperature. Generally

Ice age, Ice age is an interval of geologic time between 2 million and 10,...

Ice age is an interval of geologic time between 2 million and 10,000 years ago during that period the northern hemisphere experienced several episodes of continental glacial advan

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd