Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What are the major morphological differences between monocot plants and dicot plants?
The main separation criteria between monocots and dicots are: number of cotyledons (seed leaf) in seeds, one in monocots and two in dicots; pattern of leaf veins, parallel in monocots, reticulated in dicots; multiplicity of petal number, multiples of three in monocots, multiples of four or five in dicots; position of vascular bundles in the stem, scattered in monocots, concentrically ringed in dicots. Grasses, sugar cane, banana tree, orchids are instances of monocots. Oaks, Sunflowers and waterlilies are examples of dicots.
In which chloroplast structure are chlorophyll molecules found? Chlorophyll molecules are placed in an organized manner in order to increase the exposure to light on the thylak
Asymmetrical and Spherical - Metazoa Some creatures are asymmetrical: no matter which way we try to divide them through the middle, no two halves would appear alike. In simple
Question 1: Differentiate between Traditional, complementary and alternative medicines. Cite examples for each type. Definition of Traditional, alternative medicines and
Question 1 Give an account of t-RNA 2 Write short note on Competitive inhibition 3 What are ketone bodies? Write the mechanism of ketogenesis 4 Describe the properties of nucle
What is the typical morphological feature of nematodes that differentiates them from platyhelminthes? Nematodes are also called as roundworms. As the name shows they are not fl
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. After the morula stage what is the next stage? What is the morphological feature that defines this stage? In the blastula stage the compactness is lost and an internal cavit
At 1 AM, an impermeable membrane separates a 1 liter solution of 2M KCl in the left compartment from a 1 liter solution containing both 1M NaCl and 1M KCl in the right compartment.
List the causes of implant failure due to improper surgical technique and placement. Failure due to surgical techniques and improper placement: a) Off axis / severe angulati
Types of suture materials The suture technique and material selection should be based on a knowledge of the desired goals of the respective surgical procedures and the physical
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd