Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Monosaccharide Sugar - carbohydrate consisting of a single sugar unit
o Glucose aldose o Fructose ketose
o 5-carbon sugars have 4 alcohols and one aldehyde/ketone group pentose o 6-carbon sugars have 6 functional groups hexose o 3-carbon sugars have 3 functional groups triose
o the C=O group reacts with the -OH group to form an O link o 6 carbon chains... Aldose form 6 member ring Ketose form 5 member ring o Pentose sugars form 5 member rings
o Chain structure C3 has the OH on the other side o Alpha α-glucose C1 has the H above the plane of the ring and the OH below the plane Starch and glycogen o Beta β-Glucose C1 has the H below the plane of the ring and the OH above the plane Cellulose and chitan
o Mannose has the orientation on C2 switched
o Galactose has the orientation on C4 switched
What is the phenotype? Phenotype is every observable characteristic of a living being conditioned by its genes. A few phenotypes may be altered by nongenetic factors (for insta
Describe Alternation of Generations? Alternation of Generations : In meiosis, four haploid daughter cells are formed from one diploid mother cell. The life cycles of sexuall
Bovine leukemia Bovine leukemia, also known as bovine lymphosarcoma or leucosis, is a lymphoproliferative neoplastic disease of bovines. The virus belongs to genus Deltaretrov
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
list all of the parts of a generalized cell that might be involved support movement coordination respiration digestion transportation excr production making proteins and reproducti
What is the function of the citric acid cycle? The hnction ofthe citric acid cycle can be discussed as follows. The intermediates of citric acid cycle are used as precursor
State the term - Halsted Reitan varies with the particular test Scoring for the Halsted Reitan varies with the particular test, such that individual scores may be expressed in
Classify phylum mollusca?
Reduction of stress on the implant - Removal of prosthesis when it is in the non aesthetic areas - Occlusal adjustment - Reducing Cantilever length - Occlusal splint
When a ventricQlar septa1 defect (VSD) is present, with no aortic stenosis, the peak velocitgr across the defect reflects the difference in pressure between the right ventricle an
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd