Monosaccharide sugars, Biology

Assignment Help:

Monosaccharide Sugar - carbohydrate consisting of a single sugar unit

  • Have an aldehyde or a ketone group and 2-5 alcohol groups depending of the # of carbons

             o    Glucose  aldose
             o    Fructose  ketose

  • Common sugars

             o    5-carbon sugars  have 4 alcohols and one aldehyde/ketone group  pentose
             o    6-carbon sugars  have 6 functional groups  hexose
             o    3-carbon sugars  have 3 functional groups  triose

  • In solution monosaccharides 5-6 carbons long  form more stable ring structures

            o    the C=O group reacts with the -OH group to form an O link
            o    6 carbon chains...
                  Aldose  form 6 member ring
                   Ketose  form 5 member ring
            o    Pentose sugars form 5 member rings

 

                                            1055_Monosaccharide Sugar.png                                                   2484_Monosaccharide Sugar 1.png                                      

 

  • Glucose

            o    Chain structure
                  C3 has the OH on the other side
            o    Alpha α-glucose
                 C1 has the H above the plane of the ring and the OH below the plane
                 Starch and glycogen
            o    Beta β-Glucose
                 C1 has the H below the plane of the ring and the OH above the plane
                  Cellulose and chitan

  • Many hexose structures resemble glucose but have a different orientation of the alcohol group

           o    Mannose has the orientation on C2 switched

 

           o    Galactose has the orientation on C4 switched

 


Related Discussions:- Monosaccharide sugars

What is the phenotype, What is the phenotype? Phenotype is every observ...

What is the phenotype? Phenotype is every observable characteristic of a living being conditioned by its genes. A few phenotypes may be altered by nongenetic factors (for insta

Describe alternation of generations, Describe Alternation of Generations? ...

Describe Alternation of Generations? Alternation of Generations :  In meiosis, four haploid daughter cells are formed from one diploid mother cell. The life cycles of sexuall

Bovine leukemia, Bovine leukemia Bovine leukemia, also known as bovine...

Bovine leukemia Bovine leukemia, also known as bovine lymphosarcoma or leucosis, is a lymphoproliferative neoplastic disease of bovines. The virus belongs to genus Deltaretrov

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

#title a&p, list all of the parts of a generalized cell that might be invol...

list all of the parts of a generalized cell that might be involved support movement coordination respiration digestion transportation excr production making proteins and reproducti

What is the function of the citric acid cycle, What is the function of the ...

What is the function of the citric acid cycle? The hnction ofthe  citric acid cycle can be discussed as  follows. The  intermediates of citric acid cycle are used as  precursor

State the term - halsted reitan varies, State the term - Halsted Reitan var...

State the term - Halsted Reitan varies with the particular test Scoring for the Halsted Reitan varies with the particular test, such that individual scores may be expressed in

What is the reduction of stress on the implant, Reduction of stress on the ...

Reduction of stress on the implant - Removal of prosthesis when it is in the non aesthetic areas - Occlusal adjustment - Reducing Cantilever length - Occlusal splint

Continuous wave doppler, When a ventricQlar septa1 defect (VSD) is present,...

When a ventricQlar septa1 defect (VSD) is present, with no aortic stenosis, the peak velocitgr  across the defect reflects the difference in pressure between the right ventricle an

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd