Molecules that make possible active transport, Biology

Assignment Help:

Which are the molecules that make possible active transport through membranes?

Ans) Active transport is made by particular membrane proteins. These proteins are known as "pumps" because they "pump" the moving substance through the membrane using energy from ATP molecules.


Related Discussions:- Molecules that make possible active transport

Causes of variation, CAUSE S OF VARIATION - Effect of environmental co...

CAUSE S OF VARIATION - Effect of environmental conditions Change in the gene pattern like - (a) Random distribution of homologous genes in meiosis (b) Crossing over

Unit membrane model, structure explanation of unit membrane model

structure explanation of unit membrane model

What is the prevailing wind direction, what is the prevailing wind directio...

what is the prevailing wind direction in equatorial regions affected by the trade winds? a) The wind blows from east to west b) the wind blows from west to east

Describe the non direct approach, Q. Describe the Non Direct Approach? ...

Q. Describe the Non Direct Approach? The counsellor's participation is minimal; here the counsellee freely expresses. The counsellor pays attention to the emotion and attitudes

Protozoans - regeneration in invertebrates, Protozoans - Regeneration i...

Protozoans - Regeneration in Invertebrates Most single celled animals such as protists, i.e. protozoans, regenerate very well. If part of the cytoplasm is removed from the

The genetic code within a dna molecule, How is a genetic trait determined b...

How is a genetic trait determined by the genetic code within a DNA molecule? A DNA molecule has 4 dissimilar bases, either CGTA. Any specific combination of these things forms

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Human development, Human Development Human development is a continuous...

Human Development Human development is a continuous procedure that begins when the ovum from a female is fertilised via sperm from a male to form the zygote. Growth and differ

Point out research findings related to cancer prevention, Point out Researc...

Point out Research Findings Related to Cancer Prevention? In this section we shall discuss some of the research findings related to cancer prevention. Many of the natural, canc

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd