Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Which are the molecules that make possible active transport through membranes?
Ans) Active transport is made by particular membrane proteins. These proteins are known as "pumps" because they "pump" the moving substance through the membrane using energy from ATP molecules.
CAUSE S OF VARIATION - Effect of environmental conditions Change in the gene pattern like - (a) Random distribution of homologous genes in meiosis (b) Crossing over
structure explanation of unit membrane model
what is the prevailing wind direction in equatorial regions affected by the trade winds? a) The wind blows from east to west b) the wind blows from west to east
Q. Describe the Non Direct Approach? The counsellor's participation is minimal; here the counsellee freely expresses. The counsellor pays attention to the emotion and attitudes
Protozoans - Regeneration in Invertebrates Most single celled animals such as protists, i.e. protozoans, regenerate very well. If part of the cytoplasm is removed from the
How is a genetic trait determined by the genetic code within a DNA molecule? A DNA molecule has 4 dissimilar bases, either CGTA. Any specific combination of these things forms
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Human Development Human development is a continuous procedure that begins when the ovum from a female is fertilised via sperm from a male to form the zygote. Growth and differ
Point out Research Findings Related to Cancer Prevention? In this section we shall discuss some of the research findings related to cancer prevention. Many of the natural, canc
give the theory of spermatogenesis
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd