Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Fatty acid breakdown happens in the cytosol of prokaryotes in plants in peroxisomes and in the mitochondrial matrix of all other eukaryotes. By entering the mitochondrial matrix, the fatty acid is activated by creating a thioester link with CoA. This reaction is catalyzed by acyl CoA synthase (also known as fatty acid thiokinase) which is there on the outer mitochondrial membrane, and uses a molecule of ATP. The entire reaction is irreversible due to the subsequent hydrolysis of PPi to two molecules of Pi.
Undescended Testes (Cryptorchidism) Undescended testes is a ccmmon disorder. It may be unilateral and may be classified as ectopic cryptorchidism, when the testes are normal
What is the significance of Choanocyte? Unique collar-shaped cells whose flagella are responsible for generating water current in the sponge. As flagella beats, food particles
Explain in details Class Hirudenia - Leeches? This group includes the leeches. Most leeches grow in tropical freshwater habitats, and are familiar to most people as bloodsucker
Explain about the Net Protein Ratio (NPR)? This method was introduced by Bender and Doell (1957) and is a modification of the PER method. In this method, an allowance is made f
Explain the term - Social Attention and Environmental Influences The importance of social environment and early experiences in neurodevelopment is increasingly recognised. Due
Define the types of Ketogenic Diets? The ketogenic diet is initiated after an initial period of Pasting for 24-72 hours, till ketosis is established. There are two types of ket
Composition of Body Fluids All body fluids - plasma, interstitial and intracellular have one common feature i.e. they are formed mostly of water. You would be amazed to know t
Determine the Modification of native starch Modification of native starch can be either physical or chemical. Chemical modification includes reaction of starch with acid or al
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. How many ATP molecules are made after glycolysis? Glycolysis is a process similar to glucose degradation in fermentation it produces final balances two molecules of ATP for
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd