Middle ear, Biology

Assignment Help:

MIDDLE EAR -

  1. Protected by tympanic bone. It's cavity is tympanic cavity.
  2. It is lined by simple cilliated columnar epithelium. It is connected to naso pharynx by Eustachian canal.
  3. Here valve is present, generally closed, during shouting, yawning & swallowing it is opened.
  4. Due to it on both sides of tympanum, pressure of air is equalized. Inflamation of eustachian tube is eutachitis.
  5. Cold may block the eustachian tube & the pressure outside and inside the middle ear do not equalige. So divers and fliers do not work when they have cold. Outside preesure is increases in diving & decresed in flying.
  6. Middle ear is connected to internal ear by fenestra ovalis or oval window and fenestra rotundus or round window.
  7. By fenestra ovalis sound waves enter in to internal ear. By fenestra rotundus sound waves come out if strong.
  8. Between tympanum and fenestra ovalis there is a chain of 3 bones collectively called as ear ossicles.
  9. Three bones are malleus, inchus & stapes. Malleus is hammer shaped attached to tympanum.
  10. Inchus is anvil shaped. Stapes is stirrup shaped, smallest bone with bone marrow.
  11. All bone are articuluted by hinge joint & fixed in position due to their respective ligaments.
  12. These bones are modification of articular, quadrate and hyomendibular.
  13. In frog collumella auris present, which is modification of hyomendibular.
  14. Ear ossicles transmit the vibration from the tympanic membrane to internal ear and also amplify them about 20 times.
  15. Two small muscles tensor tympani and stapedius, joined to malleus and stapes respectively, contract to prevent damage to the dellicate internal ear at the time of loud sound.

Related Discussions:- Middle ear

Hardy - weinberg law, HARD Y - WEINBERG LAW - Proposed by G.H. Hard...

HARD Y - WEINBERG LAW - Proposed by G.H. Hardy and W. Weinberg in 1908 independently. The law states "the frequency of genes or alleles in a population remains constant

What is telophase, What is telophase? Telophase is the cell divides apa...

What is telophase? Telophase is the cell divides apart and screws itself.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Processing of wastes from food industry, Processing of wastes from food ind...

Processing of wastes from food industry Various cellulosic wastes are available abundantly from food processing industry such as fruits and vegetable processing, breweries, st

INVERTEBRATES - STRUCTURE & FUNCTION, 1. Write general characters of phylum...

1. Write general characters of phylum mollusca and classify it upto classes, giving at least two examples of each class.

#title.protozoa classes., #question.give the classes of protozoa phylum in ...

#question.give the classes of protozoa phylum in detail with examples .

What are the tupes of aortic aneurysm surgery, What are the tupes of Aortic...

What are the tupes of Aortic Aneurysm Surgery? Types of Surgery :  Technique of surgery and the approach depends on the site of thoracic or thoraco abdominal aortic aneuiysm.

What is angiosperms, What is Angiosperms? Angiosperms are the second ma...

What is Angiosperms? Angiosperms are the second major group of plants that bear seeds. Angiosperms (seeds in vessels) differ from gymnosperms in that their seeds develop within

Explain about sex chromosomes, What is the other name given to sex chromos...

What is the other name given to sex chromosomes? Sex chromosomes are also known as allosomes (the other chromosomes that are not sex chromosomes are known as autosomes).

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd