microbiology, Biology

Assignment Help:
control of microorganisms by chemical method.

Related Discussions:- microbiology

Can you explain radula, Q What is the radula? What is the function of this ...

Q What is the radula? What is the function of this organ? Some molluscs have a tongue-like structure with harsh saliences similar to small teeth. This structure is called as ra

Cell, compare and contrast plant cell and animal cell with labeling diagram...

compare and contrast plant cell and animal cell with labeling diagrams

Sedentary or light activity lifestyles - physical activity, How Sedentary o...

How Sedentary or light activity lifestyles affects Physical Activity? These people have occupations that do not demand much physical effort, we not required to walk long distan

Define the need for classification of plants and animals, Define the Need f...

Define the Need for classification of Plants and Animals? First of all there is a need to know what classification is? Let us define in simple term. Classification is placing o

Mold, Does mold have roots? When mold is inside on wood - are there roots t...

Does mold have roots? When mold is inside on wood - are there roots that go into substrate? I am trying to find this out today if possible to evaluate a remediator''s plan. I am wo

Effects on weather - air pollutants, Effects on Weather - Air pollutants ...

Effects on Weather - Air pollutants Dust, smoke and other suspended particulate matter reduce visibility. Fly-ash also affects visibility by intercepting and scattering solar

What are classes into which the phylum arthropoda is divide, Q. What are th...

Q. What are the classes into which the phylum Arthropoda is divided? What are the three major ones and some of their representative species? The three main classes of arthropod

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Physical properties of carbohydrates, PHYSICA L PROPERTIES All mono...

PHYSICA L PROPERTIES All monosaccharides which have an asymmetric carbon are able to rotate polarized light either to left side ( laevorotatory ) or right side ( dextroro

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd